Claims

What is claimed is:
1. A loading/unloading system for a container terminal, the system comprising: a plurality of shore cranes, an operation lane area between two rails of the shore cranes, an automatic container yard area, an operation area from a rear side of a landside rail of the shore cranes to the automatic container yard area, and facilities behind the automatic container yard area;
wherein:
the operation lane area between two rails of the shore cranes comprises a lambdoidal reverse operation area of inner container trucks, a ship lofting operation area, and a loading/unloading operation area of the inner container trucks, which are physically isolated by fences;
the operation area from the rear side of the landside rail of the shore cranes to the automatic container yard area comprises a hatch cover area, an unlocking and locking area of the inner container trucks, an unlocking and locking buffer area, a passing area of the inner container trucks and a charging area of the inner container trucks, which are not physically isolated, thereby facilitating cooperation among the areas in operation;
the automatic container yard area comprises yards and a plurality of automatic rail-mounted gantry cranes disposed in parallel to the yards;
the facilities behind the automatic container yard area comprise intelligent arrival and departure gates, an in-yard parking lot and an auxiliary building area; and
the container terminal is arranged in a quay layout.
2. The system of claim 1, wherein the ship lofting operation area and the loading/unloading operation area of the inner container trucks are independent and are isolated by the fences.
3. The system of claim 1, wherein the hatch cover area is used to stack hatchway covers of ships, or used as a parking area of the inner container trucks without operation.
4. The system of claim 1, wherein the lambdoidal reverse operation area of the inner container trucks is for realizing reverse operation of the containers.
5. A loading/unloading method for the container terminal using the system of claim 1, the method comprising:
S1: shipping and unshipping operation: during unshipping, unloading containers from a container ship by utilizing the plurality of shore cranes, transferring the containers to target operation positions of the yards, then hoisting, by the automatic rail-mounted gantry cranes, the containers to appointed locations, and allowing the inner container trucks to continuously enter a next operation cycle, where containers carrying hazardous goods are transferred by shore crane trolleys to the outer container trucks waiting in the ship lofting operation area and are directly transported out of the terminal area by the outer container trucks along a regulated route; and during unshipping, carrying out reverse operations as that during unshipping; and
S2: container collecting and dispatching operations: in a collecting process, allowing the outer container trucks to drive from arrival and departure gates and a parking lot and further to enter appointed positions of the operation area of the yards, hoisting, by the automatic rail-mounted gantry cranes, the containers to appointed locations, and allowing the outer container trucks unloading the containers to continuously leave a harbor district; and during container dispatching, carrying out reverse operations as that during container collecting....

Claims

What is claimed is:
1. A telescopic stool, comprising:
a first connection ring;
a second connection ring;
a plurality of clamping seats;
a plurality of anti-deformation members; and
a plurality of tightening members;
wherein:
the second connection ring is disposed on an upper part of an inner side of the first connection ring;
the plurality of clamping seats are equidistantly disposed on a lower part of an inner side of the second connection ring;
the plurality of anti-deformation members is clamped on the plurality of clamping seats, respectively;
the plurality of tightening members is disposed on the plurality of clamping seats, respectively;
each of the plurality of anti-deformation members comprises an active connection seat, a fixed block, a first active clamping block, an active connection rod, a second active clamping block, a support block, an elastic spring, and a fixed support rod;
the active connection seat is clamped on the plurality of clamping seats;
the fixed block is fixed on one end of the active connection seat;
the first active clamping block is rotatably connected to the fixed block;
the first active clamping block is fixedly connected to one end of the active connection rod, and the other end of the active connection rod is fixedly connected to the second active clamping block; the second active clamping block is rotatably connected to the support block; each support block is fixedly connected to two fixed support rods, and each fixed support rod is disposed through the upper part of the first connection ring.
2. The telescopic stool of claim 1, wherein two adjacent ends of two adjacent second active clamping blocks are fixedly connected to two ends of the elastic spring, respectively; bottom ends of two adjacent first active clamping blocks are fixedly connected to two ends of an elastic rope.
3. The telescopic stool of claim 1, wherein the plurality of tightening members each comprise a connection seat, an L-shaped clamp rod, a threaded connecting rod, and a threaded fastening cap; the connection seat is disposed on the active connection seat and is located at an outer bottom of the second connection ring; the L-shaped clamp rod is disposed on two top sides of the connection seat; the threaded connecting rod is fixedly connected to a front end to the L-shaped clamp rod; and the threaded connecting rod is disposed through the upper part of the first connection ring and in threaded connection to the threaded fastening cap.
4. The telescopic stool of claim 1, wherein two press blocks are fixedly connected to two sides of a front end of the fixed support rod, respectively, and the two press blocks are disposed on the upper part of the first connection ring in the vicinity of the fixed support rod; and the two press blocks and the first connection ring are detachably connected to fourth anchor bolts.
5. The telescopic stool of claim 1, wherein the active connection seat is detachably connected to each of the plurality of clamping seats through a first anchor bolt.
6. The telescopic stool of claim 1, wherein the first active clamping block is detachably connected to the fixed block through a second anchor bolt.
7. The telescopic stool of claim 1, wherein the second active clamping block is detachably connected to the support block through a third anchor bolt....

Claims

What is claimed is:
1. A folding table, comprising:
a table top comprising a bottom;
a plurality of table legs hinged to the table top;
a plurality of folding stools detachably fixed to the bottom of the table top; and
a plurality of folding support bars disposed between the table top and the table legs;
wherein:
the folding support bars comprise first support bars pivotally connected to the table legs and second support bars pivotally connected to the table top;
the first support bars are hinged to the second support bars; a clamping part is disposed between each first support bar and each second support bar to position the first support bar and the second support bar when the folding table is in an unfolding state; and
the plurality of table legs comprise a first pair of table legs and a second pair of table legs; the first pair of table legs each comprise an arc-shaped part, and in a folding state, the first pair of table legs and the second pair of table legs are overlapped on the bottom of the table top, and the first pair of table legs are covered by the second pair of table legs.
2. The folding table of claim 1, further comprising a connection board disposed on the bottom of the table top, and the plurality of table legs being hinged to the connection board.
3. The folding table of claim 1, wherein a first fixed rod is disposed between the first pair of table legs, and a second fixed rod is disposed between the second pair of table legs.
4. The folding table of claim 3, wherein the first fixed rod is disposed on an inner side of the first pair of table legs, and the second fixed rod is disposed on an outer side of the second pair of table legs.
5. The folding table of claim 3, wherein both the first fixed rod and the second fixed rod comprise a cushion block; and when the folding table is in a folding state, the cushion block is in contact with the folding stools.
6. The folding table of claim 5, wherein the cushion block comprises a head for fixing the folding stools, a tail, and a connection part connecting the head and the tail; the tail is cone-shaped; the connection part comprises an annular groove; the first fixed rod and the second fixed rod comprise a plurality of through holes; the tail is disposed through the through holes, and the connection part is embedded in the through holes of the first fixed rod and the second fixed rod.
7. The folding table of claim 1, wherein both the first pair of table legs and the second pair of table legs comprises fasteners, and when the folding table is in a folding state, the first pair of table legs and the second pair of table legs are locked by the fasteners.
8. The folding table of claim 1, wherein the bottom of the table top comprises a fixed belt; and the fixed belt is an elastic rope configured to fix the folding stools on the bottom.
9. The folding table of claim 1, wherein the clamping part is disposed on the first support bar; the second support bar comprises a recess matched with the clamping part; in an unfolding state, the clamping part is embedded in the recess to limit the rotation of the table legs.
10. The folding table of claim 1, wherein the first support bar comprises a first lower locating hole and a first upper locating hole; the second support bar comprises a second upper locating hole and a second lower locating hole; the second support bar is hinged to the table top through the second upper locating hole; the first support bar is hinged to the table legs through the first lower locating hole; and the first support bar is hinged to the second support bar through the first upper locating hole and the second lower locating hole.
11. The folding table of claim 10, wherein the first support bar further comprises two protrusions disposed equidistantly at two sides of the first upper locating hole; the second support bar comprises a fixing hole; when the folding table is in a folding or unfolding state, one of the two protrusions is limited in the fixing hole.
12. A folding table, comprising:
a table top comprising a bottom;
a plurality of table legs hinged to the table top;
a plurality of folding stools detachably fixed to the bottom of the table top; and
a plurality of folding support bars disposed between the table top and the table legs;
wherein:
the folding support bars comprise first support bars pivotally connected to the table legs and second support bars pivotally connected to the table top;
the first support bars are hinged to the second support bars; a clamping part is disposed between each first support bar and each second support bar to position the first support bar and the second support bar when the folding table is in an unfolding state; and
the bottom of the table top comprises a plurality of grooves and a locating block disposed in each groove; the folding stools are disposed in grooves one by one; and the folding stools each comprise a positioning groove matched with the locating block.
13. The folding table of claim 12, further comprising a connection board disposed on the bottom of the table top, and the plurality of table legs being hinged to the connection board.
14. The folding table of claim 12, wherein the bottom of the table top comprises a fixed belt; and the fixed belt is an elastic rope configured to fix the folding stools on the bottom.
15. The folding table of claim 12, wherein the clamping part is disposed on the first support bar; the second support bar comprises a recess matched with the clamping part; in an unfolding state, the clamping part is embedded in the recess to limit the rotation of the table legs.
16. The folding table of claim 12, wherein the first support bar comprises a first lower locating hole and a first upper locating hole; the second support bar comprises a second upper locating hole and a second lower locating hole; the second support bar is hinged to the table top through the second upper locating hole; the first support bar is hinged to the table legs through the first lower locating hole; and the first support bar is hinged to the second support bar through the first upper locating hole and the second lower locating hole.
17. The folding table of claim 16, wherein the first support bar further comprises two protrusions disposed equidistantly at two sides of the first upper locating hole; the second support bar comprises a fixing hole; when the folding table is in a folding or unfolding state, one of the two protrusions is limited in the fixing hole....

Claims

What is claimed is:
1. An air gun, comprising:
a cartridge comprising a launching chamber;
a cylinder comprising an air chamber;
an air valve;
a first pin; and
a second pin;
wherein:
the air valve is disposed in the air chamber and partially extends out of the cylinder to connect to the cartridge;
the air valve is a single, integrally formed structure and comprises a first connection column, a second connection column, and a connection block; the connection block is connected to the first connection column and the second connection column and is integrally formed with the first connection column and the second connection column; and an air passage comprising an air inlet and an air outlet is disposed within the air valve;
the air passage further comprises a first passage, a second passage, and a third passage; the first passage axially extends within the first connection column; the third passage axially extends within the second connection column; and the second passage extends through the connection block and communicates the first passage with the third passage;
the first connection column is disposed in the air chamber and detachably connected to the cylinder, and the second connection column is detachably connected to the cartridge;
the air inlet is configured to communicate the air chamber with the first connection column;
the air outlet is configured to communicate the launching chamber with the second connection column; and
the first pin is disposed through the first connection column and is movable relative to the cylinder to open and close the air inlet;
the cartridge extends axially into the second connection column from a first opening of the third passage;
the second pin has a solid structure and extends axially into the second connection column from a second opening of the third passage; and
a sliding seat is disposed on the cylinder; the second pin is connected to the sliding seat; the sliding seat is movable between a first position and a second position;
when the sliding seat is in the first position, the second pin is positioned within the launching chamber and closes the air outlet; and when the sliding seat is in the second position, the second pin is retracted from the launching chamber and opens the air outlet.
2. The air gun of claim 1, wherein an outer circumference of the first connection column comprises a plurality of counterbores; the cylinder comprises a plurality of through holes corresponding to the plurality of counterbores one by one; a fastener is disposed in each of the plurality of through holes; and the fastener is configured to fix and position the first connection column on the cylinder.
3. The air gun of claim 2, wherein the first passage is disposed through the first connection column, and a first driving unit and a second driving unit are disposed axially on two ends of the first passage, respectively; the second driving unit is movable along the cylinder between a third position and a fourth position; in the third position, the second driving unit butts against the first pin and the first pin opens the air inlet; in the fourth position, the second driving unit is disconnected with the first pin, and the first pin closes the air inlet.
4. The air gun of claim 3, wherein when the first pin closes the air inlet, one end of the first pin away from the first driving unit extends out of the first connection column; when the second driving unit moves from the fourth position to the third position, the second driving unit drives the first pin to open the air inlet.
5. The air gun of claim 3, wherein the first driving unit comprises a connecting cylinder and a first elastic piece; the connecting cylinder is in threaded connection to the connection column and comprises a first assembly chamber; the first assembly chamber communicates with the first passage and the air chamber; the first elastic piece is disposed in the first assembly chamber and butts against the first pin; the first elastic piece is elastically contractive in a movement direction of the first pin, to drive the first pin to move towards the second driving unit and extend out of the connection column.
6. The air gun of claim 3, wherein the second driving unit comprises a sliding block and a second elastic piece; the sliding block comprises a second assembly chamber; the second assembly chamber is opened on one side of the sliding block away from the first pin, and the second elastic piece is disposed in the second assembly chamber and butts against the cylinder; a trigger is disposed on the cylinder and is rotatable with a joint of the trigger and the cylinder as an axis to engage with or detach from the sliding block; when the trigger detaches from the sliding block, the sliding block is driven by the second elastic piece to butt against the first pin, and the first pin moves to open the air inlet; when the trigger engages with the sliding block, the sliding block detaches from the first pin, and the first pin is driven by the first driving unit to move and close the air inlet.
7. The air gun of claim 2, wherein a sealing sleeve is disposed in the first passage; the sealing sleeve surrounds the first pin and is adjacent to the air inlet; an outer wall of the sealing sleeve comprises an annular groove, and a seal ring is disposed in the annular groove....

Claims

What is claimed is:
1. A mechanical magazine, comprising:
a casing, the casing comprising an ammunition inlet, an ammunition outlet, and an ammunition passage extending from the ammunition inlet to the ammunition outlet; and
a mechanical driver, the mechanical driver comprising a rotation disc and an energy storage unit;
wherein,
the mechanical driver is disposed on one side of the casing and is configured to drive ammunition rounds to move from the ammunition inlet to the ammunition outlet and to be ejected out of the casing;
the rotation disc is rotationally connected to the casing to push the ammunition rounds to move along the ammunition passage;
the energy storage unit is disposed on the rotation disc, and when the rotation disc rotates relative to the casing, the energy storage unit is subjected to elastic deformation to store or release energy;
when in use, the rotation disc rotates in a direction towards the ammunition inlet, the energy storage unit is compressed to save energy; when the energy is released, the energy storage unit drives the rotation disc to rotate in a direction towards the ammunition outlet, causing the ammunition rounds to move in the direction towards the ammunition outlet and to be ejected out of the casing;
the ammunition passage comprises a multiple-round passage, a single-round passage, and a conversion space connecting the multiple-round passage and the single-round passage; the single-round passage surrounds the rotation disc and extends from the conversion space to the ammunition outlet; and a guide disc is disposed in the multiple-round passage to guide the ammunition rounds in the multiple-round passage to the single-round passage one by one; and
the mechanical driver further comprises a transmission gear coaxially disposed with the rotation disc; the guide disc is meshed with the transmission gear and comprises a plurality of protrusion groups; the plurality of protrusion groups are radially spaced apart on the guide disc; each of the plurality of protrusion groups comprises a plurality of protrusions circumferentially spaced apart on the guide disc; the plurality of protrusions in a first protrusion group are misaligned with the plurality of protrusions in a second protrusion group in a circumferential direction of the guide disc to form a plurality of gaps; the second protrusion group is adjacent to the first protrusion group, and each gap allows a single ammunition round to pass through one time.
2. The mechanical magazine of claim 1, wherein a locking mechanism is disposed between the rotation disc and the casing; the locking mechanism is configured to restrict the rotation disc from rotating in the direction towards the ammunition outlet, whereby the energy storage unit stays in an energy storage state.
3. The mechanical magazine of claim 2, wherein the locking mechanism comprises a limit gear disposed on the rotation disc and a limit arm disposed on the casing; the limit arm is meshed with the limit gear to restrict the rotation disc from rotating in the direction towards the ammunition outlet, whereby the energy storage unit stays in an energy storage state.
4. The mechanical magazine of claim 1, wherein the casing comprises a front cover, a partition, and a rear cover; the ammunition passage is formed by the partition and the rear cover; the rear cover comprises an accommodating ring, and the transmission gear and the guide disc are disposed in the accommodating ring; a guide member is disposed in the multiple-round passage and extends to the accommodating ring; and the guide member is configured to guide the ammunition rounds to the guide disc.
5. The mechanical magazine of claim 3, wherein the casing comprises a front cover, a partition, and a rear cover; the ammunition passage is formed by the partition and the rear cover; a front chamber is formed by the front cover and the partition, and the limit gear is disposed in the front chamber; the limit arm passes through the partition and is connected to the limit gear in the front chamber; the mechanical driver comprises a rotary knob; the rotary knob is disposed on an outer side of the front cover and sequentially extends into the front chamber and the ammunition passage to connect with the limit gear and the rotation disc.
6. The mechanical magazine of claim 1, wherein a stop block is disposed on one side of the ammunition outlet of the casing; the stop block is movable relative to the casing to open and close the ammunition outlet; the casing further comprises a groove and the stop block is disposed in the groove; a spring is disposed in the groove to drive the stop block to move and close the ammunition outlet; and one side of the stop block facing away from the ammunition outlet is an inclined plane.
7. A mechanical magazine, comprising:
a casing, the casing comprising an ammunition inlet, an ammunition outlet, and an ammunition passage extending from the ammunition inlet to the ammunition outlet; and
a mechanical driver, the mechanical driver comprising a rotation disc and an energy storage unit;
wherein,
the mechanical driver is disposed on one side of the casing and is configured to drive ammunition rounds to move from the ammunition inlet to the ammunition outlet and to be ejected out of the casing;
the rotation disc is rotationally connected to the casing to push the ammunition rounds to move along the ammunition passage;
the energy storage unit is disposed on the rotation disc, and when the rotation disc rotates relative to the casing, the energy storage unit is subjected to elastic deformation to store or release energy;
when in use, the rotation disc rotates in a direction towards the ammunition inlet, the energy storage unit is compressed to save energy; when the energy is released, the energy storage unit drives the rotation disc to rotate in a direction towards the ammunition outlet, causing the ammunition rounds to move in the direction towards the ammunition outlet and to be ejected out of the casing;
the ammunition passage comprises a multiple-round passage, a single-round passage, and a conversion space connecting the multiple-round passage and the single-round passage; the single-round passage surrounds the rotation disc and extends from the conversion space to the ammunition outlet; and a guide disc is disposed in the multiple-round passage to guide the ammunition rounds in the multiple-round passage to the single-round passage one by one; and
the mechanical driver further comprises a transmission gear coaxially disposed with the rotation disc and meshed with the guide disc; an acceleration gear is meshed with the guide disc; the acceleration gear comprises an eccentric wheel; when the energy storage unit releases energy, the eccentric wheel is configured to swing, to speed up the rotation of the rotation disc towards the ammunition outlet.
8. The mechanical magazine of claim 7, wherein the casing comprises a front cover, a partition, and a rear cover; the ammunition passage is formed by the partition and the rear cover; the rear cover comprises an accommodating ring, and the transmission gear and the guide disc are disposed in the accommodating ring; a guide member is disposed in the multiple-round passage and extends to the accommodating ring; and the guide member is configured to guide the ammunition rounds to the guide disc.
9. The mechanical magazine of claim 7, wherein a locking mechanism is disposed between the rotation disc and the casing; the locking mechanism is configured to restrict the rotation disc from rotating in the direction towards the ammunition outlet, whereby the energy storage unit stays in an energy storage state.
10. The mechanical magazine of claim 9, wherein the locking mechanism comprises a limit gear disposed on the rotation disc and a limit arm disposed on the casing; the limit arm is meshed with the limit gear to restrict the rotation disc from rotating in the direction towards the ammunition outlet, whereby the energy storage unit stays in an energy storage state.
11. The mechanical magazine of claim 10, wherein the casing comprises a front cover, a partition, and a rear cover; the ammunition passage is formed by the partition and the rear cover; a front chamber is formed by the front cover and the partition, and the limit gear is disposed in the front chamber; the limit arm passes through the partition and is connected to the limit gear in the front chamber; the mechanical driver comprises a rotary knob; the rotary knob is disposed on an outer side of the front cover and sequentially extends into the front chamber and the ammunition passage to connect with the limit gear and the rotation disc.
12. The mechanical magazine of claim 7, wherein a stop block is disposed on one side of the ammunition outlet of the casing; the stop block is movable relative to the casing to open and close the ammunition outlet; the casing further comprises a groove and the stop block is disposed in the groove; a spring is disposed in the groove to drive the stop block to move and close the ammunition outlet; and one side of the stop block facing away from the ammunition outlet is an inclined plane.
13. A mechanical magazine, comprising:
a casing, the casing comprising an ammunition inlet, an ammunition outlet, and an ammunition passage extending from the ammunition inlet to the ammunition outlet; and
a mechanical driver, the mechanical driver comprising a rotation disc and an energy storage unit;
wherein,
the mechanical driver is disposed on one side of the casing and is configured to drive ammunition rounds to move from the ammunition inlet to the ammunition outlet and to be ejected out of the casing;
the rotation disc is rotationally connected to the casing to push the ammunition rounds to move along the ammunition passage;
the energy storage unit is disposed on the rotation disc, and when the rotation disc rotates relative to the casing, the energy storage unit is subjected to elastic deformation to store or release energy;
when in use, the rotation disc rotates in a direction towards the ammunition inlet, the energy storage unit is compressed to save energy; when the energy is released, the energy storage unit drives the rotation disc to rotate in a direction towards the ammunition outlet, causing the ammunition rounds to move in the direction towards the ammunition outlet and to be ejected out of the casing;
the ammunition passage comprises a multiple-round passage, a single-round passage, and a conversion space connecting the multiple-round passage and the single-round passage; the single-round passage surrounds the rotation disc and extends from the conversion space to the ammunition outlet; and a guide disc is disposed in the multiple-round passage to guide the ammunition rounds in the multiple-round passage to the single-round passage one by one; and
a turntable is disposed on one side of the conversion space facing the rotation disc; and the turntable comprises elastic material.
14. The mechanical magazine of claim 13, wherein a locking mechanism is disposed between the rotation disc and the casing; the locking mechanism is configured to restrict the rotation disc from rotating in the direction towards the ammunition outlet, whereby the energy storage unit stays in an energy storage state.
15. The mechanical magazine of claim 14, wherein the locking mechanism comprises a limit gear disposed on the rotation disc and a limit arm disposed on the casing; the limit arm is meshed with the limit gear to restrict the rotation disc from rotating in the direction towards the ammunition outlet, whereby the energy storage unit stays in an energy storage state.
16. The mechanical magazine of claim 15, wherein the casing comprises a front cover, a partition, and a rear cover; the ammunition passage is formed by the partition and the rear cover; a front chamber is formed by the front cover and the partition, and the limit gear is disposed in the front chamber; the limit arm passes through the partition and is connected to the limit gear in the front chamber; the mechanical driver comprises a rotary knob; the rotary knob is disposed on an outer side of the front cover and sequentially extends into the front chamber and the ammunition passage to connect with the limit gear and the rotation disc.
17. The mechanical magazine of claim 13, wherein a stop block is disposed on one side of the ammunition outlet of the casing; the stop block is movable relative to the casing to open and close the ammunition outlet; the casing further comprises a groove and the stop block is disposed in the groove; a spring is disposed in the groove to drive the stop block to move and close the ammunition outlet; and one side of the stop block facing away from the ammunition outlet is an inclined plane.
18. The mechanical magazine of claim 13, wherein the casing comprises a front cover, a partition, and a rear cover; the ammunition passage is formed by the partition and the rear cover; the rear cover comprises an accommodating ring, and the transmission gear and the guide disc are disposed in the accommodating ring; a guide member is disposed in the multiple-round passage and extends to the accommodating ring; and the guide member is configured to guide the ammunition rounds to the guide disc....

Claims

What is claimed is:
1. A method for extending shelf life of germ-remained rice, the method comprising:
1) evenly spreading the germ-remained rice on a sheet tray, and moderately moistening the germ-remained rice; and
2) packing the germ-remained moistened rice, and irradiating the germ-remained rice with an electron beam; and
wherein moderately moistening comprises transferring the sheet tray to a constant climate chamber, and moistening the germ-remained rice at a temperature of 20-30° C. and a relative humidity of 88-99% for 1.0-2.0 hours without spraying water, until moisture seeps through the germ-remained rice; and
the germ-remained rice is germ-remained indica rice or germ-remained japonica rice;
the germ-remained indica rice is moistened to a moisture content of not more than 14.5%, and the germ-remained japonica rice is moistened to a moisture content of not more than 15.5%; and
wherein the germ-remained rice moistened is irradiated with an electron beam at a dose of 0.5 to 1.0 kGy and stored at 25° C. from 75-120 days.
2. The method of claim 1, wherein in 1), the germ-remained rice has a germ retention rate of more than or equal to 80%.
3. The method of claim 1, wherein in 1), the germ-remained rice is evenly spread on the sheet tray to a thickness of equal to or less than 2 cm.
4. The method of claim 1, wherein in 2), packing comprises sealing the moistened germ-remained rice in a bag without removing the air; and the germ-remained rice is evenly spread in the bag to a thickness of not more than 1 cm.
5. The method of claim 4, wherein the bag comprises nylon composite.
6. Germ-remained rice treated by the method of claim 1....

Claims

What is claimed is:
1. A few-shot urban remote sensing image information extraction method based on meta learning and attention, the method comprising:
step 1, building a few-shot urban remote sensing information pre-trained model, wherein during a pre-training stage, pre-training network learning is performed for a few-shot set to fully learn feature information of existing samples and obtain initial feature parameters and a deep convolutional network backbone of the few-shot set; the few-shot urban remote sensing information pre-trained model is a network structure comprising a convolutional layer, a pooling layer and a fully-connected layer, and comprises five sections of convolutional network where each section comprises two or three convolutional layers, and an end of each section is connected to one maximum pooling layer to reduce a size of a picture; the number of convolutional kernels inside each section is same, and when closer to the fully-connected layer, the number of convolutional kernels is larger;
step 2, constructing a “time-space-spectrum-angle” attention model to enable the pre-training network to focus on important “time-space-spectrum-angle” information in a training process, suppress noise and redundant information, and improve classification performance of the pre-training model;
step 3, establishing a synergy mechanism of meta learning and attention and realizing few-shot urban remote sensing information extraction, performing parallel association learning for feature parameters obtained by the “time-space-spectrum-angle” attention model and initial feature parameters and introducing a regularizer to minimize cross entropy and structural risk and realize full digging for few-shot information; and
step 4, obtaining remote sensing data through a satellite and fusing a full color image and a multi-spectral image to obtain a multi-spectral image, and using the above three steps to perform urban ground feature information extraction; wherein:
a feature vector of the “time-space-spectrum-angle” is obtained in the following formula:
k
i
′
⇐
k
i
-
η
⁢
∇
k
i
∇
k
i
=
∑
j
=
1
n
⁢
1
[
y
=
i
]
⁢
(
k
i
-
e
j
,
l
)
sum
(
1
[
y
=
i
]
)
v
i
⇐
v
i
-
η
⁢
∇
v
i
∑
j
=
1
C
⁢
(
v
i
,
j
-
η
⁢
∇
v
i
,
j
)
∇
v
i
=
∑
j
=
1
n
⁢
1
[
y
=
i
]
⁢
(
v
i
-
p
j
,
l
)
sum
(
1
[
y
=
i
]
)
wherein ki represents a final category feature center of an i-th category, ki represents an initial category feature center of the i-th category, ∇ represents a gradient, ∇ki represents a gradient-optimized category feature center of the i-th category, j represents a number of unlabeled samples, I represents a number of labeled samples, ej,i represents a feature corresponding to the labeled samples and the unlabeled samples, sum ( ) represents a sum of values in parentheses, vi represents a probability distribution feature center of the i-th category, vi,j represents probability distribution feature centers of the i-th category obtained by updating category probability vectors of j samples of the i-th category, n represents a total number of samples, C represents a number of categories in a dataset, e represents an initial feature vector, p represents a “time-space-spectrum-angle” feature vector, Pj,l represents a prediction probability corresponding to the labeled samples of the l-th category and the unlabeled samples of the j-th category, n represents an update coefficient, and 1(y=i) represents an indicator function.
2. The method of claim 1, wherein the five sections of convolutional network in the few-shot urban remote sensing information pre-trained model is implemented as follows:
a first section of convolutional network comprises two convolutional layers and one maximum pooling layer, with an output channel number being 64 and an output size being 112×112×64;
a second section of convolutional network comprises two convolutional layers and one maximum pooling layer, with an output channel number being 128 and an output size being 56×56×128;
a third section of convolutional network comprises three convolutional layers and one maximum pooling layer, with an output channel number being 256 and an output size being 28×28×256;
a fourth section of convolutional network comprises three convolutional layers and one maximum pooling layer, with an output channel number being 512 and an output size being 14×14×512;
a fifth section of convolutional network comprises three convolutional layers and one maximum pooling layer, with an output channel number being 512 and an output size being 7×7×512;
wherein results output by the five sections of convolutional network are represented as one-dimensional vector in a flattened manner and then input into a Dropout layer corresponding to a first fully-connected layer and then input into a Dropout layer corresponding to a second fully-connected layer and finally input into a third fully-connected layer, wherein an output node of the third fully-connected layer is 1000; and the third fully-connected layer obtains a classification output probability and a classification result by using softmax function at the same time.
3. The method of claim 1, wherein in the “time-space-spectrum-angle” attention model, for a three-dimensional input X, two feature-compressed global feature descriptions are obtained firstly through maximum pooling and average pooling along a channel dimension; then, by a gate mechanism of hard-sigmoid, a weight Xss € (0,1) of a temporal feature, a spatial feature, a spectral feature and an angular feature is obtained; finally, the original input X is multiplied by the weight Xss;
continuous learning is performed by the network in a training process, and a weight corresponding to the important “time-space-spectrum-angle” information approaches 1; and a weight corresponding to non-important or negative noise and redundant information approaches 0.
4. A few-shot urban remote sensing image information extraction system based on meta learning and attention, comprising a processor and a memory, wherein the memory is configured to store program instructions and the processor is configured to invoke the program instructions stored in the memory to perform the few-shot urban remote sensing image information extraction method based on meta learning and attention of claim 1.
5. A few-shot urban remote sensing image information extraction system based on meta learning and attention, comprising a non-transitory computer-readable storage medium, wherein the non-transitory computer-readable storage medium stores computer programs which are executed to perform the few-shot urban remote sensing image information extraction method based on meta learning and attention of claim 1....

Claims

What is claimed is:
1. A method for preparing a carrier for a mercury adsorbent, the method comprising:
1) Mixing hydrated alumina with an organic acid to obtain a mixture A, wherein the organic acid is ethylenediaminetetraacetic acid; and
2) Adding tetraalkylsiloxane to the mixture A, thus obtaining a mixture B; stirring the mixture B in a closed condition; spraying atomized water into the mixture B; and stirring to yield the carrier.
2. The method of claim 1, wherein in 1), hydrated alumina is mixed with the organic acid at −10° C. to 40° C.
3. The method of claim 1, wherein in 1), the organic acid is 1%-10% by mass of the hydrated alumina in the mixture A.
4. The method of claim 3, wherein the organic acid is 6% by mass of the hydrated alumina in the mixture A.
5. The method of claim 1, wherein in 2), the tetraalkylsiloxane is 3%-15% by mass of the hydrated alumina.
6. The method of claim 1, wherein the tetraalkylsiloxane is tetramethylsiloxane or tetraethoxysilane.
7. The method of claim 1, wherein the atomized water is 3-8 times tetraalkylsiloxane by mass.
8. The method of claim 1, wherein in 2), the atomized water is added and stirred for 1-24 h....

Claims

What is claimed is:
1. A method for inhibiting in vivo tumor metastasis within a patient, the method comprising:
A) identifying key heterogeneous molecules driving that drive tumor metastasis by using a prediction system to obtain a sorted list of heterogeneous molecules, the prediction system comprising a non-transitory computer readable storage medium having computer instructions stored in the medium and a processor for executing the computer instructions, identifying the key heterogeneous molecules that drive tumor metastasis by using the prediction system to obtain a sorted list of heterogeneous molecules comprising:
(1) inputting a first quantitative analysis result of proteins and a second quantitative analysis result of proteins to the prediction system; the first quantitative analysis result of proteins is a collection of quantitative analysis results of various protein expression levels in tumor metastases of the patient before drug intervention, and the second quantitative analysis result of proteins is a collection of quantitative analysis results of various protein expression levels in residual tumor metastases of the patient after drug intervention;
(2) comparing, by using the prediction system, the first quantitative analysis result of proteins and the second quantitative analysis result of proteins, and including proteins with expression changes within a predetermined range in a candidate protein set;
(3) constructing, by using the prediction system to employ a protein interaction network analysis tool, experimentally validated protein interaction networks based on the candidate protein set, supplementing the protein interaction networks by utilizing signal pathways of the candidate protein; including most important proteins in each protein interaction network as independent heterogeneous molecules in an independent molecular set; constructing, by using the prediction system to employ a protein interaction network prediction tool and based on the candidate protein set, a protein interaction prediction network according to a protein interaction law; and including proteins in the candidate protein set that do not participate in any protein interaction prediction network as independent heterogeneous molecules in the independent molecular set; and
(4) calculating, by using the prediction system, a hazard ratio (HR) value of each heterogeneous molecule in the independent molecular set, and sorting the heterogeneous molecules based on the HR value, to form the sorted list of heterogeneous molecules; and
B) conducting a sequential intervention on the heterogeneous molecules within the patient by administering to the patient, in sequence, inhibitors or agonists that respectively target the heterogeneous molecules according to an order in the sorted list of heterogeneous molecules, thereby inhibiting in vivo tumor metastasis within the patient.
2. The method of claim 1, wherein the first quantitative analysis result of proteins and the second quantitative analysis result of proteins are acquired through high-throughput protein sequencing; and the high-throughput protein sequencing comprises protein mass spectrometry analysis.
3. The method of claim 1, wherein the proteins with expression changes within the predetermined range are proteins whose expression levels after drug intervention are 0.95-1.05 times higher than those before drug intervention.
4. The method of claim 1, wherein the proteins with expression changes within the predetermined range are first screened and then included in the candidate protein set; the proteins that are screened meet the following conditions: a number of specific peptide segments is ≥2, and is not a predicted protein; a coverage of amino acids of identified peptide segments of a current protein is ≥10%; a quantification frequency of the current protein is ≥2, and a sequencing quality comprehensive score of the current protein is ≥200; evidence in a database shows the current protein is related to tumor progression; the specific peptide segments refer to a specific peptide segment used to identify the current protein; the predicted protein refers to an attribute that defines a reliability of the current protein in Uniport or National Center for Biotechnology Information (NCBI) databases as a predicted protein; the identified peptide segments refer to a specific peptide segment that can be used to indicate the current protein being detected; the quantification frequency of the current protein refers to a number of repetitions of the current protein being quantitatively detected.
5. The method of claim 1, wherein the protein interaction network analysis tool comprises a STRING network tool; the system further comprises a signal pathway database for accessing the signal pathways of the candidate protein, and the signal pathway database comprises Kyoto Encyclopedia of Genes and Genomes (KEGG), Small Molecule Pathway Database (SMPDB), WikiPathways, Cell Signaling Technology, BioCarta Pathway, Pathway Commons, and Pathway Interaction Database (PID); the protein interaction network prediction tool comprises a Gene Multiple Association Network Integration Algorithm (GeneMANIA) network tool, Unified Human Interactome (UniHI) network tool, and Hitpredict network tool.
6. The method of claim 5, wherein the system further comprises a Cytoscape tool for constructing and supplementing the protein interaction networks, and for constructing a protein interaction prediction network.
7. The method of claim 1, wherein the most important proteins in each protein interaction network are identified through characteristic analysis; the characteristic analysis comprises analyzing the importance, degree, and radiancy of each protein in the protein interaction network; and proteins with the highest importance, degree, and radiancy are the most important proteins in the protein interaction network.
8. The method of claim 1, wherein during the calculating and sorting, the HR value of each heterogeneous molecule is calculated as follows: obtaining sequencing data of tumors from a public database, obtaining a standardized counting matrix of genes corresponding to the heterogeneous molecules from the sequencing data, and performing batch single factor Cox regression on the genes to obtain the HR value.
9. The method of claim 8, wherein the public database comprises The Cancer Genome Atlas (TCGA), International Cancer Genome Consortium (ICGC), and Gene Expression Omnibus (GEO).
10. The method of claim 1, wherein during the calculating and sorting, a sorting rule is: the heterogeneous molecules with HR values greater than or equal to 1 are directly sorted in reverse order according to their HR values, and the heterogeneous molecules with HR values less than 1 are sorted in reverse order according to their 1/HR values....

Claims

What is claimed is:
1. A rotor for a disc permanent magnet motor, comprising:
a first rotor core;
a second rotor core; and
a plurality of magnetic tiles;
wherein:
the first rotor core comprises a first annular ring and a plurality of first magnetic blocks protruding at intervals from an outer side of the first annular ring in a circumferential direction, and a first groove is formed between every two adjacent first magnetic blocks;
the second rotor core comprises a second annular ring and a plurality of second magnetic blocks protruding at intervals from an outer side of the second annular ring in a circumferential direction, and a second groove is formed between every two adjacent second magnetic blocks;
the first rotor core and the second rotor core are axially embedded with each other; the first magnetic blocks are embedded in second grooves, and the second magnetic blocks are embedded in first grooves;
each of the plurality of second magnetic blocks comprises two sides, and a first side groove and a second side groove are respectively formed between the two sides and two adjacent first magnetic blocks; an axial thickness H1 of the second magnetic blocks is smaller than an axial thickness H2 of the first magnetic blocks, so that a first top surface of the second magnetic blocks is lower than a second top surface of two adjacent first magnetic blocks, thereby forming a top groove on the second magnetic blocks; and
each of the plurality of magnetic tiles comprises a top tile, a first side tile and a second side tile, and the first side tile and the second side tile are respectively connected to two ends of the top tile; the top tile is embedded in the top groove, and the first side tile and the second side tile are respectively embedded in the first side groove and the second side groove, respectively.
2. The rotor of claim 1, wherein each of the first magnetic blocks is connected to the first annular ring through a first connecting rib; a thickness of the first annular ring is the same as that of the first connecting rib, and the axial thickness of the first magnetic blocks is greater than the thickness of the first annular ring.
3. The rotor of claim 2, wherein each of the second magnetic blocks is connected to the second annular ring through a second connecting rib; a thickness of the second annular ring is the same as that of the second connecting rib, and the axial thickness of the second magnetic blocks is greater than the thickness of the second annular ring.
4. The rotor of claim 3, wherein a cross-sectional shape of the magnetic tile is a “U” shape.
5. The rotor of claim 1, wherein the top tile is a fan-shaped plate.
6. The rotor of claim 5, wherein the first magnetic blocks and the second magnetic blocks are fan-shaped blocks.
7. The rotor of claim 1, wherein the first side tile and the second side tile are flat plates, and are radially aslant embedded into the first side groove and the second side groove, respectively, with an inclination angle α.
8. The rotor of claim 7, wherein the inclination angle α is in the range of 2.5°-7.5°.
9. The rotor of claim 3, wherein the first annular ring is integrated with the first connecting rib and located at a top end of the rotor; the second annular ring is integrated with the second connecting rib and located at a bottom end of the rotor; and the first annular ring is spaced apart from the second annular ring.
10. The rotor of claim 1, wherein the first side tile and the second side tile are perpendicular to the top tile or are inclined relative to the top tile.
11. The rotor of claim 1, wherein two sides of a top surface of each of the first magnetic blocks comprise a first flange, and two first flanges abut against the top tile to limit an axial movement of the magnetic tiles; an inner end and an outer end of each of the second magnetic blocks comprise a second flange, and the top tile is disposed between two second flanges, and thus a radial movement of the magnetic tiles is limited.
12. The rotor of claim 1, wherein magnetization directions of the magnetic tiles are consistent, from inside to outside or from outside to inside.
13. A disc permanent magnet motor comprising a stator assembly and a rotor assembly; wherein the stator assembly is axially magnetically coupled to the rotor assembly, and the rotor assembly comprises the rotor of claim 1....

Claims

What is claimed is:
1. A stator lamination, comprising:
a middle part;
an annular yoke; and
a plurality of stator teeth;
wherein:
the middle part comprises a central hole;
the plurality of stator teeth extend from an inner side of the annular yoke and are evenly distributed on the annular yoke;
a wire slot is formed between every two adjacent stator teeth, whereby a plurality of wire slots are formed on the annular yoke;
each of the plurality of stator teeth comprises a tooth root and a pole shoe disposed at one end of the tooth root;
the stator lamination has an outer diameter D1 ranging from 61.75 mm to 68.25 mm, and the central hole has a diameter D2 ranging from 31.6 mm to 35 mm;
the plurality of wire slots are evenly distributed around an edge of a circle, and a bottom part of each wire slot is tangent to the circle, and the circle has a diameter D3 ranging from 54.72 mm to 60.48 mm;
the tooth root has a tooth width L1 ranging from 4.75 mm to 5.25 mm, and the pole shoe has a thickness H1 ranging from 0.3 L1 to 0.45 L1; and
the stator lamination comprises eight stator teeth and eight wire slots.
2. The stator lamination of claim 1, wherein the tooth width L1 of the tooth root is 5 mm, and the thickness H1 of the pole shoe is in the range of 1.5 mm to 2.25 mm.
3. The stator lamination of claim 2, wherein the annular yoke has a minimum thickness H2 ranging from 3.5 mm to 3.9 mm.
4. The stator lamination of claim 3, wherein the outer diameter D1 of the stator lamination is 65 mm, the central hole has a diameter D2 of 33.3 mm, the diameter D3 of the circle is 57.6 mm, the thickness H1 of the pole shoe is 2.15 mm, and the minimum thickness H2 of the annular yoke is 3.7 mm.
5. The stator lamination of claim 4, wherein each of the plurality of wire slots comprises an arc segment and two straight segments respectively tangent to both ends of the arc segment, and each tooth root comprises a tooth edge perpendicular to the two straight segments.
6. The stator lamination of claim 1, wherein the annular yoke has a minimum thickness H2 ranging from 3.5 mm to 3.9 mm.
7. The stator lamination of claim 6, wherein the outer diameter D1 of the stator lamination is 65 mm, the central hole has a diameter D2 of 33.3 mm, the diameter D3 of the circle is 57.6 mm, the thickness H1 of the pole shoe is 2.15 mm, and the minimum thickness H2 of the annular yoke is 3.7 mm.
8. The stator lamination of claim 7, wherein each of the plurality of wire slots comprises an arc segment and two straight segments respectively tangent to both ends of the arc segment, and each tooth root comprises a tooth edge perpendicular to the two straight segments.
9. An electric motor, comprising:
a rotor assembly;
a stator assembly; and
a casing assembly;
wherein
the stator assembly is disposed inside the casing assembly; the rotor assembly is disposed within the stator assembly;
the stator assembly comprises a stator core, an end insulator, and a plurality of coil windings, and the stator core comprises a plurality of stator laminations stacked together;
the rotor assembly comprises a rotating shaft and a rotor core comprising a plurality of rotor laminations stacked together;
each of the plurality of rotor laminations comprises a shaft hole and a plurality of rotor slots; the rotating shaft is disposed through shaft holes, and the plurality of rotor slots are uniformly distributed around an edge of each of the plurality of rotor laminations; the electric motor further comprises a plurality of conductive elements respectively disposed inside the rotor slots; a rotor tooth is formed between every two adjacent rotor slots; and
each of the plurality of stator laminations comprises eight wire slots; and a ratio of a number of wire slots in each stator lamination to a number of rotor slots in each rotor lamination is in the range of 8:13 to 8:24.
10. The electric motor of claim 9, wherein the ratio of the number of wire slots in each stator lamination to the number of rotor slots in each rotor lamination is 8:15.
11. The electric motor of claim 10, wherein each of the plurality of rotor laminations has a diameter D4 ranging from 31.6 mm to 35 mm; the shaft hole has a diameter D5 ranging from 7.6 mm to 8.4 mm; and the rotor tooth has a width L2 ranging from 2.328 mm to 2.573 mm.
12. The electric motor of claim 11, wherein the diameter D4 of each of the plurality of rotor laminations is 33.3 mm; the diameter D5 of the shaft hole is 8 mm; and the width L2 of the rotor tooth is 2.45 mm....

Claims

What is claimed is:
1. A slew-rate control circuit, comprising:
a proportional calculation circuit, configured to parallelly receive a plurality of first signals within a current preset period, generate a first indicating voltage according to a plurality of adjusted first signals within a previous preset period and the plurality of first signals within the current preset period, and generate a second indicating voltage according to the plurality of adjusted first signals within the previous preset period and a plurality of second signals that are inverted from the plurality of first signals within the current preset period, wherein the first indicating voltage indicates a first numerical relationship between a number of low-level adjusted first signals within the previous preset period that respectively transition into high-level first signals within the current preset period, and a number of high-level adjusted first signals within the previous preset period that respectively transition into low-level first signals within the current preset period, and the second indicating voltage indicates a second numerical relationship between the number of low-level adjusted first signals within the previous preset period that respectively transition into high-level second signals within the current preset period, and the number of high-level adjusted first signals within the previous preset period that respectively transition into low-level second signals within the current preset period;
a logic operation circuit, coupled to the proportional calculation circuit, wherein the logic operation circuit is configured to receive the first indicating voltage and the second indicating voltage, and generate an operation result according to a numerical relationship between the first indicating voltage, and first and second reference voltages, and a numerical relationship between the second indicating voltage, and the first and second reference voltages, wherein the first reference voltage is greater than the second reference voltage; and
an output adjustment circuit, coupled to the logic operation circuit, wherein the output adjustment circuit is configured to receive the operation result, and determine whether to invert the plurality of first signals within the current preset period to correspondingly generate a plurality of adjusted first signals within the current preset period according to the operation result.
2. The slew-rate control circuit of claim 1, wherein the first reference voltage is an upper limit of a preset slew rate range, and the second reference voltage is a lower limit of the preset slew rate range.
3. The slew-rate control circuit of claim 1, wherein the proportional calculation circuit comprises:
a first proportional calculation subcircuit, configured to parallelly receive the plurality of first signals within the current preset period, and generate the first indicating voltage according to the first numerical relationship; and
a second proportional calculation subcircuit, configured to parallelly receive the plurality of first signals within the current preset period, invert the plurality of first signals within the current preset period to obtain the plurality of second signals, and generate the second indicating voltage according to the second numerical relationship.
4. The slew-rate control circuit of claim 3, wherein the first proportional calculation subcircuit comprises a plurality of branches,
wherein the plurality of branches are coupled in parallel, and a voltage value of each first signal within the current preset period is input into a respective one of the plurality of branches,
wherein for each of the plurality of branches, after a transition from a corresponding adjusted first signal of a first level state within the previous preset period to a corresponding first signal of a second level state within the current preset period, this branch conducts when the first level state is different from the second level state, at which time the first indicating voltage is generated at a common end of the plurality of branches.
5. The slew-rate control circuit of claim 4, wherein each branch in the plurality of branches of the first proportional calculation subcircuit comprises a PMOS transistor, an NMOS transistor, and a resistor, wherein the PMOS transistor and the NMOS transistor are coupled in parallel, a first end of the parallel-coupled PMOS transistor and the NMOS transistor receives a voltage value of the corresponding first signal within the current preset period, and a second end of the parallel-coupled PMOS transistor and the NMOS transistor is coupled to the resistor, wherein the NMOS transistor and the PMOS transistor are turned on when the first level state is different from the second level state.
6. The slew-rate control circuit of claim 3, wherein the second proportional calculation subcircuit comprises a plurality of branches,
wherein the plurality of branches are coupled in parallel, and a voltage value of each second signal within the current preset period is input into a respective one of the plurality of branches,
wherein for each of the plurality of branches, after a transition from a corresponding adjusted first signal of a first level state within the previous preset period to a corresponding second signal of a third level state within the current preset period, this branch conducts when the first level state is different from the third level state, at which time the second indicating voltage is generated at a common end of the plurality of branches.
7. The slew-rate control circuit of claim 6, wherein each branch in the plurality of branches of the second proportional calculation subcircuit comprises a PMOS transistor, an NMOS transistor, and a resistor, wherein the PMOS transistor and the NMOS transistor are coupled in parallel, a first end of the parallel-coupled PMOS transistor and the NMOS transistor receives a voltage value of the corresponding second signal within the current preset period, and a second end of the parallel-coupled PMOS transistor and the NMOS transistor is coupled to the resistor, wherein the NMOS transistor and the PMOS transistor are turned on when the first level state is different from the third level state.
8. The slew-rate control circuit of claim 1, wherein the logic operation circuit comprises:
a first operation circuit, coupled to the proportional calculation circuit, configured to generate a first initial operation result according to the numerical relationship between the first indicating voltage, and the first and second reference voltages;
a second operation circuit, coupled to the proportional calculation circuit, configured to generate a second initial operation result according to the numerical relationship between the second indicating voltage, and the first and second reference voltages; and
a third operation circuit, coupled to the first operation circuit and the second operation circuit, configured to receive the first initial operation result and the second initial operation result, perform a logic operation on the first initial operation result and the second initial operation result, and generate the operation result that indicates whether to invert the plurality of first signals within the current preset period.
9. The slew-rate control circuit of claim 8, wherein
when the first indicating voltage is greater than the first reference voltage or less than the second reference voltage, the first initial operation result is in a first logic state; and
when the first indicating voltage is not greater than the first reference voltage and not less than the second reference voltage, the first initial operation result is in a second logic state, wherein the first logic state is different from the second logic state.
10. The slew-rate control circuit of claim 8, wherein
when the second indicating voltage is greater than the first reference voltage or less than the second reference voltage, the second initial operation result is in a third logic state; and
when the second indicating voltage is not greater than the first reference voltage and not less than the second reference voltage, the second initial operation result is in a fourth logic state, wherein the third logic state is different from the fourth logic state.
11. The slew-rate control circuit of claim 8, wherein the first operation circuit comprises:
a first comparator, wherein a non-inverting input end of the first comparator receives the first indicating voltage, an inverting input end of the first comparator receives the first reference voltage, and an output end of the first comparator outputs a first comparison result;
a second comparator, wherein a non-inverting input end of the second comparator receives the second reference voltage, an inverting input end of the second comparator receives the second indicating voltage, and an output end of the second comparator outputs a second comparison result; and
an XOR gate, wherein the XOR gate performs an XOR operation on the first comparison result and the second comparison result, and generates the first initial operation result.
12. The slew-rate control circuit of claim 8, wherein the second operation circuit comprises:
a third comparator, wherein a non-inverting input end of the third comparator receives the first reference voltage, an inverting input end of the third comparator receives the second indicating voltage, and an output end of the third comparator outputs a third comparison result;
a fourth comparator, wherein a non-inverting input end of the fourth comparator receives the second indicating voltage, an inverting input end of the fourth comparator receives the second reference voltage, and an output end of the fourth comparator outputs a fourth comparison result; and
a first AND gate, wherein the first AND gate performs an AND operation on the third comparison result and the fourth comparison result, and generates the second initial operation result.
13. The slew-rate control circuit of claim 8, wherein the third operation circuit comprises:
a second AND gate, coupled to the first operation circuit and the second operation circuit, configured to perform an AND operation on the first initial operation result and the second initial operation result, and generate the operation result.
14. The slew-rate control circuit of claim 8, wherein the operation result in a fifth logic state indicates that that the plurality of first signals within the current preset period are to be inverted; the operation result in a sixth logic state indicates that the plurality of first signals within the current preset period are not to be inverted, wherein the fifth logic state is different from the sixth logic state.
15. The slew-rate control circuit of claim 1, wherein the output adjustment circuit comprises:
a first PMOS transistor and a first NMOS transistor coupled in parallel; and
a second PMOS transistor, a third PMOS transistor, a second NMOS transistor, and a third NMOS transistor coupled in series;
wherein the operation result is input to a control end of the first PMOS transistor and a control end of the third NMOS transistor;
wherein the plurality of first signals are input to a control end of the third PMOS transistor, a control end of the second NMOS transistor, and a common node of the parallel-coupled first PMOS transistor and first NMOS transistor; and
wherein an inverted operation result is input to a control end of the first NMOS transistor and a control end of the second PMOS transistor.
16. A slew-rate control method, comprising:
obtaining, using a proportional calculation circuit, a plurality of first signals within a current preset period, a plurality of adjusted first signals within a previous preset period, and a plurality of second signals that are inverted from the plurality of first signals within the current preset period;
generating, using the proportional calculation circuit, a first indicating voltage according to the plurality of adjusted first signals within the previous preset period and the plurality of first signals within the current preset period, and generating a second indicating voltage according to the plurality of adjusted first signals within the previous preset period and the plurality of second signals within the current preset period, wherein the first indicating voltage indicates a first numerical relationship between a number of low-level adjusted first signals within the previous preset period that respectively transition into high-level first signals within the current preset period, and a number of high-level adjusted first signals within the previous preset period that respectively transition into low-level first signals within the current preset period, and the second indicating voltage indicates a second numerical relationship between the number of low-level adjusted first signals within the previous preset period that respectively transition into high-level second signals within the current preset period, and the number of high-level adjusted first signals within the previous preset period that respectively transition into low-level second signals within the current preset period;
generating, using a logic operation circuit, an operation result according to a numerical relationship between the first indicating voltage, and first and second reference voltages, and a numerical relationship between the second indicating voltage, and the first and second reference voltages, wherein the first reference voltage is greater than the second reference voltage; and
determining, using an output adjustment circuit, whether to invert the plurality of first signals within the current preset period to correspondingly generate a plurality of adjusted first signals within the current preset period according to the operation result.
17. The slew-rate control method of claim 16, wherein the proportional calculation circuit comprises a first proportional calculation subcircuit and a second proportional calculation subcircuit; wherein the slew-rate control method further comprises:
receiving, using the first proportional calculation subcircuit, the plurality of first signals within the current preset period, and generating the first indicating voltage according to the first numerical relationship; and
receiving, using the second proportional calculation subcircuit, the plurality of first signals within the current preset period, inverting the plurality of first signals within the current preset period to obtain the plurality of second signals, and generating the second indicating voltage according to the second numerical relationship.
18. The slew-rate control method of claim 16, wherein the logic operation circuit comprises a first operation circuit, a second operation circuit, and a third operation circuit, a step of generating the operation result comprises:
generating, using the first operation circuit, a first initial operation result according to the numerical relationship between the first indicating voltage, and the first and second reference voltages;
generating, using the second operation circuit, a second initial operation result according to the numerical relationship between the second indicating voltage, and the first and second reference voltages; and
performing, using the third operation circuit, a logic operation on the first initial operation result and the second initial operation result, and generating the operation result that indicates whether to invert the plurality of first signals within the current preset period.
19. A slew-rate control system, comprising:
a slew-rate control circuit, configured to parallelly receive a plurality of first signals within a current preset period, determine whether to invert the plurality of first signals within the current preset period to generate a plurality of adjusted first signals within the current preset period, according to a level relationship between a level state of each adjusted first signal in a previous preset period and a level state of a corresponding first signal in the current preset period, and a level relationship between a level state of each adjusted first signal in the previous preset period and a level state of a corresponding second signal in the current preset period, wherein a plurality of second signals are obtained by inverting the plurality of first signals within the current preset period; and
a signal output circuit, coupled to the slew-rate control circuit, configured to parallelly output the plurality of adjusted first signals within the current preset period.
20. The slew-rate control system of claim 19, wherein the slew-rate control circuit comprises:
a proportional calculation circuit, configured to parallelly receive the plurality of first signals within the current preset period, generate a first indicating voltage according to a plurality of adjusted first signals within the previous preset period and the plurality of first signals within the current preset period, and generate a second indicating voltage according to the plurality of adjusted first signals within the previous preset period and the plurality of second signals within the current preset period, wherein the first indicating voltage indicates a first numerical relationship between the number of low-level adjusted first signals within the previous preset period that respectively transition into high-level first signals within the current preset period, and the number of high-level adjusted first signals within the previous preset period that respectively transition into low-level first signals within the current preset period, and the second indicating voltage indicates a second numerical relationship between the number of low-level adjusted first signals within the previous preset period that respectively transition into high-level second signals within the current preset period, and the number of high-level adjusted first signals within the previous preset period that respectively transition into low-level second signals within the current preset period;
a logic operation circuit, coupled to the proportional calculation circuit, configured to generate an operation result according to a numerical relationship between the first indicating voltage, and first and second reference voltages, and a numerical relationship between the second indicating voltage, and the first and second reference voltages, wherein the first reference voltage is greater than the second reference voltage; and
an output adjustment circuit, coupled to the logic operation circuit, configured to receive the operation result, and determine whether to invert the plurality of first signals within the current preset period to correspondingly generate the plurality of adjusted first signals within the current preset period according to the operation result....

Claims

What is claimed is:
1. A method for promoting expression of a foreign gene in a plant, the method comprising: constructing a recombinant vector comprising a soybean gene promoter pEIF1 or an intron-comprising soybean gene promoter pEIF1-I, and introducing the recombinant vector into the plant; the promoter pEIF1 being represented by SEQ ID NO: 5, and the intron-comprising promoter pEIF1-I being represented by SEQ ID NO: 6.
2. The method of claim 1, wherein the foreign gene is beta-glucuronidase (GUS) gene.
3. The method of claim 1, wherein the plant is soybean, and the expression of the foreign gene occurs in cotyledons, radicles, plumules, true leaves, compound leaves, buds, petioles, internodes, roots and root nodules of the soybean.
4. The method of claim 1, wherein the plant is Arabidopsis, and the expression of the foreign gene occurs in whole plant, flower and pod of the Arabidopsis.
5. The method of claim 1, wherein the plant is tobacco, and the expression of the foreign gene occurs in leaves of the tobacco.
6. A method for preparing a recombinant vector comprising a soybean gene promoter, the method comprising inserting a soybean gene promoter pEIF1 or pEIF1-I into a vector pCAMBIA1391Z-BAR, wherein inserting the soybean gene promoter pEIF1 or pEIF1-I into the vector pCAMBIA1391Z-BAR comprises using a PCR amplification fragment of pEIF1 or pEIF1-I as a template, and cloning the PCR amplification fragment into a soybean stable transformation vector pCAMBIA1391Z-BAR by seamless cloning to obtain a soybean stable transformation vector pEIF1-GUS-BAR or pEIF1-I-GUS-BAR;
the vector pCAMBIA1391Z-BAR is obtained by linearizing a vector pCAMBIA1391Z with a restriction enzyme XhoI, and replacing a gene HygR with a gene BAR by seamless cloning;
the recombinant vector pEIF1-GUS-BAR is amplified using the following primers:
pEIF1-GUS-BAR-F:
(SEQ ID NO: 16)
GACCATGATTACGCCAAGCTTGGAGAGAAGTTGAACTCTGAGT
TGTG;
pEIF1-GUS-BAR-R:
(SEQ ID NO: 24)
CCAGTGAATTCCCGGGGATCCCTGATCGTAAATTTAAGGTTTCG;
the recombinant vector pEIF1-I-GUS-BAR is amplified using the following primers:
pEIF1-I-GUS-BAR-F:
(SEQ ID NO: 16)
GACCATGATTACGCCAAGCTTGGAGAGAAGTTGAACTCTGAGT
TGTG;
pEIF1-I-GUS-BAR-R:
(SEQ ID NO: 17)
CCAGTGAATTCCCGGGGATCCAAAACTTGACTCACTAAGACCA
AAGG;
the promoter pEIF1 has a nucleotide sequence of SEQ ID NO: 5, and the promoter pEIF1-I has a nucleotide sequence of SEQ ID NO: 6....

Claims

What is claimed is:
1. A three-axis Hall angle sensor, comprising: four horizontal Hall elements and eight vertical Hall elements disposed on a plane, wherein:
the eight vertical Hall elements are divided into two groups, an X-direction group and a Y-direction group, the X-direction group comprising four vertical Hall elements X1, X2, X3 and X4, and the Y-direction group comprising four vertical Hall elements Y1, Y2, Y3 and Y4; each vertical Hall element comprises four three-contact Hall components, and the four three-contact Hall components are connected end-to-end in series; the four horizontal Hall elements comprising Z1, Z2, Z3 and Z4 are in a 2×2 array arrangement; in the X-direction group, X1 and X2 are located on a left side of the four horizontal Hall elements; X2 is located between X1 and four horizontal Hall elements; X3 and X4 are located on a right side of the four horizontal Hall elements, and X3 is located between X4 and the four horizontal Hall elements;
X1 comprises the four three-contact Hall components, in which middle electrodes are AX1, BX1, CX1 and DX1 in sequence; X2 comprises the four three-contact Hall components, in which middle electrodes are AX2, BX2, CX2, and DX2 in sequence; X3 comprises the four three-contact Hall components, in which middle electrodes are AX3, BX3, CX3 and DX3 in sequence; X4 comprises the four three-contact Hall components, in which middle electrodes are AX4, BX4, CX4 and DX4 in sequence; when measuring an X-direction magnetic field, for a first vertical Hall element X1, applying a current bias between contact electrodes of BX1 and DX1, and measuring a Hall voltage VHallX1 between contact electrodes of AX1 and CX1; for a second vertical Hall element X2, applying a current bias between contact electrodes of BX2 and DX2, and simultaneously measuring a Hall voltage VHallX2 generated between AX2 and CX2; for a third vertical Hall element X3, applying a current bias between contact electrodes of CX3 and AX3, and measuring a Hall voltage VHallX3 between contact electrodes of BX3 and DX3; for a fourth vertical Hall element X4, applying a current bias between the AX4 and CX4 contact electrodes, and measuring a Hall voltage VHallX4 between contact electrodes of DX4 and BX4;
in a Y direction, vertical Hall elements Y1 and Y2 are located on an upper side of the four horizontal Hall elements, and Y2 is located between Y1 and the four horizontal Hall elements; vertical Hall elements Y3 and Y4 are located on a lower side of the four horizontal Hall elements, and Y3 is located between Y4 and the four horizontal Hall elements; Y1 comprises the four three-contact Hall components, in which middle electrodes are AY1, BY1, CY1 and DY1 in sequence; Y2 comprises the four three-contact Hall components, in which intermediate electrodes are AY2, BY2, CY2 and DY2 in sequence; Y3 comprise the four three-contact Hall components, in which intermediate electrodes are AY3, BY3, CY3 and DY3 in sequence; Y4 comprises the four three-contact Hall components, and intermediate electrodes are AY4, BY4, CY4 and DY4 in sequence;
when measuring a magnetic field in the Y direction, the following steps are taken: for a first vertical Hall element Y1, applying a current bias between DY1 and BY1, and measuring a Hall voltage VHallY1 between contact electrodes of AY1 and CY1; for a second vertical Hall element Y2, applying a current bias between BY2 and DY2, and simultaneously measuring a sensing Hall voltage VHallY2 generated between AY2 and CY2; for a third vertical Hall element Y3, applying a current bias between contact electrodes of AY3 and CY3, and measuring a Hall voltage VHallY3 between contact electrodes of DY3 and BY3; for a fourth vertical Hall element Y4, applying a current bias between the BY4 and DY4 contact electrodes, then measuring a Hall voltages VHallY4 between contact electrodes of CY4 and AY4;
each horizontal Hall element comprises four electrodes: A, B, C and D; a first horizontal Hall element Z1 is applied with a bias current between electrodes AZ1 and CZ1, and measuring a Hall voltage VHallZ1 generated between electrodes DZ1 and BZ1; for a second horizontal Hall element Z2, applying a current bias between electrodes BZ2 and DZ2, then measuring a Hall voltage VHallZ2 between electrodes AZ2 and CZ2; for a third horizontal Hall element Z3, applying a current bias between electrodes CZ3 and AZ3, then measuring a Hall voltage VHallZ3 between electrodes BZ3 and DZ3; for a fourth horizontal Hall element Z4, applying a current bias between electrodes DZ4 and BZ4, and measuring a Hall voltage VHallZ4 between electrodes CZ4 and AZ4; and the four identical Hall elements, Z1, Z2, Z3, Z4, are connected together by orthogonal coupling.
2. The three-axis Hall angle sensor of claim 1, wherein a current transmission equation of the three-axis Hall angle sensor Jn is:
J
n
=
J
n
⁢
0
·
M
(
1
)
M
=
1
1
+
a
2
+
b
2
+
c
2
⁢
(
1
+
a
2
ab
-
c
ca
+
b
c
+
ab
1
+
b
2
bc
-
a
ca
-
b
a
+
bc
1
+
c
2
)
(
2
)
a
=
μ
H
·
B
X
(
3
)
b
=
μ
H
·
B
Y
(
4
)
c
=
μ
H
·
B
Z
(
5
)
where Jn0 represents a zero magnetic field electron current density, μH=r·μ and represents a Hall mobility of electrons, r is a Hall coefficient, μ represents an electron mobility, and BX, BY, BZ respectively represent magnetic field components in X, Y and Z directions....

Claims

What is claimed is:
1. A method, comprising:
mixing starch and a first ethanol aqueous solution at a temperature of 90-150° C. to yield a mixture of a V-type granular starch and the first ethanol aqueous solution; and
adding a mixed enzyme comprising alpha-amylase and amyloglucosidase to the mixture of the V-type granular starch and the first ethanol aqueous solution, to enzymatically hydrolyze the V-type granular starch to yield a starch dispersion, wherein an addition amount of the mixed enzyme is 30,000-200,000 U per gram of the V-type granular starch; and vacuum-filtering the starch dispersion, washing for 2 to 3 times with a second ethanol aqueous solution with an ethanol concentration of 95% v/v, drying at 110° C. for 2 h, grinding, and sieving to yield V-type granular porous starch having a specific surface area of 9.99-39.94 m2/g and an average pore size of 26.61-27.61 nm.
2. The method of claim 1, wherein an ethanol concentration of the first ethanol aqueous solution is 50-80% v/v.
3. The method of claim 2, wherein a mass ratio of the starch to the first ethanol aqueous solution is between 1:2 and 1:5.
4. The method of claim 3, wherein the starch is selected from the group consisting of common corn starch, cassava starch, rice starch, barley starch, wheat starch, and potato starch.
5. The method of claim 4, wherein an enzyme activity ratio of the α-amylase to the amyloglucosidase in the mixed enzyme is between 1:2 and 1:5; and the V-type granular starch is enzymatically hydrolyzed at 20-60° C. for 6-12 h.
6. The method of claim 1, further comprising:
(1) adding the starch and the first ethanol aqueous solution to a reactor, to yield the mixture of the V-type granular starch and the first ethanol aqueous solution;
(2) cooling the mixture of the V-type granular starch and the first ethanol aqueous solution in the reactor to a temperature of 25-55° C., and adding the mixed enzyme to the reactor to enzymatically hydrolyze the V-type granular starch to yield the starch dispersion;
(3) carrying out suction filtration on the starch dispersion obtained in (2) by using a vacuum suction filtration device, washing a resulting product by using the second ethanol aqueous solution, drying the product in a first air-drying oven at 110° C. for 2 h, cooling, grinding and screening the product with an 80-mesh screen to obtain the V-type granular porous starch;
(4) dissolving a monoglyceride in het absolute ethanol, to yield a first solution;
(5) adding the V-type granular porous starch prepared in (3) into ethanol, to yield a second solution; and
(6) mixing the first solution and the second solution, carrying out suction filtration on a mixture of the first solution and the second solution, washing a resulting mixture by using the second ethanol aqueous solution, drying the mixture in a second air-drying oven, cooling, and grinding the mixture.
7. The method of claim 6, wherein in (1), the reactor operates at a rotating speed of 500 r/min for 0.5 hour; an ethanol concentration of the first ethanol aqueous solution is 50-90% v/v; a concentration of the starch is 10-40% v/v; and when a temperature in the reactor decreases to 60° C., a reaction between the starch and the first ethanol aqueous solution stops.
8. The method of claim 6, wherein in (2), the mixed enzyme is 4 mL of a mixed solution of α-amylase and amyloglucosidase with a ratio thereof 1:4; an enzymolysis time is 4-12 h; an enzymolysis temperature is 25-55° C.; and a rotating speed of a stirring blade in the reactor is 100-900 r/min.
9. The method of claim 6, wherein in (6), the first solution and the second solution are mixed at 25° C. for 2 hours at a rotating speed of 500 r/min; the resulting mixture is washed by the second ethanol aqueous solution having a concentration of 95% v/v for 2 to 3 times, dried at 50° C. for 12 h, ground and screened with an 80-mesh screen.
10. A V-type granular porous starch, prepared by the method of claim 1, having an oil adsorption rate of 276.33-528.58% by weight, and a water adsorption rate of 410.24-847.80% by weight....

Claims

What is claimed is:
1. A cutting tool for machining titanium alloy or superalloy, comprising a Me-B-N coating, wherein Me is one or more elements selected from the transition metals V, Nb, Ta, and Mo; the atomic percentages of each element are as follows: Me: 8-40% B: 15-60%, and N: 10-65%; and the Me—B—N coating comprises a MeNx phase and a BN phase.
2. The cutting tool of claim 1 wherein the Me-B-N coating has a thickness of 0.3-5 μm....

Claims

What is claimed is:
1. A method for predicting multi-type electrocardiogram (ECG) heart rhythms, the method comprising:
(1) acquiring 12-lead ECG signals from a body surface of a patient, and resampling an ECG signal of each lead to a same signal length;
(2) constructing a node mutual information pooling U-shaped graph convolution network, and extracting deep features of the ECG signals by using a feature extraction module in the graph convolution network;
(3) performing one-layer one-dimensional convolution on the deep features to obtain a graph feature matrix to be constructed, where rows of the graph feature matrix correspond to various types of arrhythmias to be predicted, and columns of the graph feature matrix correspond to feature vectors corresponding to the various types of arrhythmias; and, converting the graph feature matrix into an undirected graph G(V, A, E, W, X), where V is a point set of the undirected graph, and each node in the point set corresponds to each type of arrhythmias; E is an edge set of the undirected graph, which records a similarity between nodes; W is a weight matrix, which gives different weights to different edges; X is a node feature matrix; and, A is a node adjacency matrix;
(4) inputting the obtained undirected graph into a graph encoding module in the graph convolution network, quantitatively calculating node mutual information of the undirected graph by using the graph encoding module, and selecting a node subset with maximum mutual information to decrease a number of nodes in the undirected graph for down-sampling;
(5) inputting the undirected graph with decreased number of nodes into a graph decoding module in the graph convolution network, up-sampling, by using the graph decoding module, the undirected graph according to existing node indexes to restore an original number of nodes so as to generate a new graph feature matrix, and adding the new graph feature matrix with the graph feature matrix before down-sampling and outputting an aggregate graph feature matrix;
(6) performing summation, maximization, minimization and averaging on the aggregate graph feature matrix, splicing a result obtained after four operations into a feature vector and inputting the feature vector into a fully-connected layer, and finally mapping to obtain a probability value of each type of arrhythmias; and
(7) training the graph convolution network through a cross entropy loss function by using a large amount of ECG data and labels of various arrhythmias to predict multi-type ECG heart rhythms.
2. The method of claim 1, wherein the feature extraction module comprises a one-dimensional convolution layer, a residual network ResNet34, and an average pooling layer which are successively connected to one another, and all convolution layers in the residual network ResNet34 are replaced by one-dimensional convolution.
3. The method of claim 1, wherein the graph encoding module selects the node subset with the maximum mutual information by using the following formula:
max
Ω
⊂
V
C
⁡
(
Ω
)
;
C
⁡
(
Ω
)
=
1
K
⁢
∑
v
∈
Ω
log
⁢
σ
⁡
(
T
w
(
x
v
,
y
𝒩
v
)
)
+
1
K
2
⁢
∑
v
,
u
∈
Ω
log
⁡
(
1
-
σ
⁡
(
T
w
(
x
v
,
y
𝒩
u
)
)
)
;
T
w
(
x
v
,
y
𝒩
v
)
=
𝒮
w
(
ℰ
w
(
x
v
)
,
𝒫
w
(
y
𝒩
v
)
)
;
T
w
(
x
v
,
y
𝒩
u
)
=
𝒮
w
(
ℰ
w
(
x
v
)
,
𝒫
w
(
y
𝒩
u
)
)
;
where Ω denotes the node subset; K is the number of nodes in the node subset Ω; V is the point set of the undirected graph; C(Ω) is a mutual information quantization function between neighboring nodes in the node subset Ω; v is any node in the node subset Ω; xv denotes the feature vector of the node v; σ( ) is a sigmoid activation function; v denotes all neighboring nodes of the node v; yNv is a feature matrix comprising the feature vectors of all neighboring nodes of the node v; w( ) is a vertex embedding function; w( ) is a neighborhood embedding function; Sw( ) is a vertex-neighborhood affinity function, which has the same function as w( ) and aggregates the result of w(xv); w( ) and w( ) are implemented by a multi-layer perceptron; and, w( ) is implemented by R-hop graph convolution.
4. The method of claim 1, wherein after up-sampling or down-sampling the undirected graph, the corresponding graph feature matrix is subjected to one-layer graph convolution to update features of all nodes in the undirected graph.
5. The method of claim 1, wherein in the process of training the graph convolution network in (7), parameters in the network are iteratively updated by an Adam algorithm until the cross entropy loss function is converged.
6. The method of claim 1, wherein the cross entropy loss function is expressed as follows:
L
=
{
l
1
,
…
,
l
N
}
⊤
;
l
n
=
-
w
n
[
y
n
·
log
⁢
x
n
+
(
1
-
y
n
)
·
log
⁡
(
1
-
x
n
)
]
;
w
n
=
1
log
⁡
(
Sum
(
lable
n
)
)
;
where L is the cross entropy loss function; ln is a loss function value of a nth type of arrhythmias; N is a number of arrhythmia disease types, n is a natural number and 1≤n≤N; wn is correspondingly a weight value of the nth type of arrhythmias; xn is a predicted probability value of the nth type of arrhythmias correspondingly output by inputting the current ECG signal into the graph convolution network; yn is a label value of the nth type of arrhythmias corresponding to the current ECG signal; and, Sum(lablen) is a number of training data labels about the nth type of arrhythmias.
7. The method of claim 1, wherein in (4), node mutual information pooling is a core of the graph encoding module; a graph pooling part is associated with node selection and new graph structure generation; a mutual information score between a node and a neighboring node is calculated in the graph pooling part, and top K node indexes with the highest score are returned.
8. The method of claim 1, wherein in (5), previously recorded node indexes are required during up-sampling, and a new graph feature matrix X′=O∈{0}N×d is generated; N is a number of arrhythmia disease types, and d is a dimension of feature; the graph feature matrix to be up-sampled is added with a down-sampled graph feature matrix in the same layer to obtain an up-sampled graph feature matrix....

Claims

CLAIM
1. The ornamental design for a brush head for an electric toothbrush as shown and described....

Claims

What is claimed is:
1. A device, comprising:
a power unit; and
a plurality of adjustment units;
wherein:
the plurality of adjustment units is disposed around a suspension cable to be replaced; the power unit is configured to power the plurality of adjustment units;
each of the plurality of adjustment units comprises a support frame, a connector, and a steel strand;
the power unit comprises two jacks, each jack comprising a main body;
the support frame is door-shaped and comprises two support columns, a top part, and a bottom part; the top part comprises a first through hole, and a nut fixed on an anchor is disposed in the first through hole; a hanger rod is disposed through the anchor and the nut, and fixed in the nut;
the bottom part comprises a second through hole, and the steel strand is disposed through the second through hole;
the connector is disposed in a central cavity of the support frame; one end of the connector is screwed to a first end of the hanger rod, and a second end of the connector is fixedly connected to one end of the steel strand; another end of the steel strand is fixedly connected to the main body of each jack; and
the bottom part of the support frame abuts against a top surface of each jack; and the top part of the support frame abuts against a bottom surface of the anchor.
2. The device of claim 1, wherein each of the two jacks is a hydraulic jack; the power unit further comprises a hydraulic hose and a post-tension stressed oil pump; each hydraulic jack comprises an oil inlet and the post-tension stressed oil pump comprises an oil outlet; and the oil outlet is connected to the oil inlet through the hydraulic hose.
3. The device of claim 2, wherein the power unit further comprises a three-way hydraulic connector disposed between the post-tension stressed oil pump and the two hydraulic jacks.
4. The device of claim 1, wherein the device comprises two adjustment units disposed symmetrically about the suspension cable.
5. The device of claim 4, wherein the connector is an anchorage connector.
6. The device of claim 5, wherein each of the two jacks is a core-through hydraulic jack; and the steel strand passes through each core-through hydraulic jack.
7. The device of claim 6, wherein the second through hole is disposed in a center of the bottom part of the support frame and is aligned with the core-through hydraulic jack....

Claims

What is claimed is:
1. An auxiliary support device for a rolling-cut shear, comprising:
a lower cutting table;
a plurality of first hydraulic support cylinders;
a plurality of support plates;
a plurality of second hydraulic support cylinders shorter than the plurality of first hydraulic support cylinders;
a slide plate; and
a plurality of horizontal hydraulic cylinders;
wherein
the lower cutting table comprises a first front end comprising a first mounting groove for receiving a lower shear blade of the rolling-cut shear, a second mounting groove, and an inner plate;
a bottom wall of the second mounting groove comprises a plurality of first bolt holes and a plurality of first recesses;
the inner plate is embedded in the second mounting groove through a plurality of bolts passing through the plurality of first bolt holes;
the inner plate comprises a plurality of second bolt holes and a plurality of second recesses; and the plurality of support plates lean against the inner plate;
the plurality of first hydraulic support cylinders and the plurality of horizontal hydraulic cylinders are disposed in the plurality of first recesses; each of the plurality of first hydraulic support cylinders comprises a first support rod; the slide plate comprises a first transverse plate, a second transverse plate, a third transverse plate, and a fourth transverse plate; a top end of the first support rod abuts against a bottom end of the fourth transverse plate; a second front end of each of the plurality of first hydraulic support cylinders is connected to a first rear end of each of the plurality of second hydraulic support cylinders through a connection rod; each of the plurality of second hydraulic support cylinders comprises a second support rod; and bottom ends of the first transverse plate, the second transverse plate, and the third transverse plate abut against top ends of second support rods, respectively; and
each of the plurality of horizontal hydraulic cylinders comprises a third support rod, and a second rear end of each of the plurality of first hydraulic support cylinders is connected to a third front end of the third support rod.
2. The device of claim 1, wherein the plurality of first hydraulic support cylinders synchronously control corresponding first support rods to extend and retract; the plurality of second hydraulic support cylinders synchronously control corresponding second support rods to extend and retract; the first support rods and the second support rods synchronously extend and retract with a speed; the plurality of horizontal hydraulic cylinders synchronously control corresponding third support rods to extend and retract; all hydraulic support cylinders are a hydraulic servosystem, and each of the hydraulic support cylinders is equipped with a built-in magnetostrictive displacement sensor to provide real-time feedback on a position of a corresponding support rod.
3. The device of claim 2, wherein a first bottom surface of each of the plurality of first hydraulic support cylinders and each of the plurality of second hydraulic support cylinders comprises a sliding groove configured to fit with a slide rail fixed on ground of a workshop; a top surface of the slide rail is flush with a second bottom surface of the lower cutting table; and a leading end of the slide rail is oriented to the same direction as a leading end of the lower cutting table.
4. The device of claim 3, wherein second rear ends of the plurality of first hydraulic support cylinders are embedded in the plurality of second recesses and the plurality of first recesses; the plurality of second recesses and the plurality of first recesses are in line with slide rails; two sides of the plurality of horizontal hydraulic cylinders are disposed in the plurality of first recesses; a third bottom surface of each of the plurality of horizontal hydraulic cylinders is flush with second bottom surface of the lower cutting table; and a third rear end of each of the plurality of horizontal hydraulic cylinders is disposed in the plurality of first recesses.
5. The device of claim 1, wherein the inner plate is attached to the bottom wall of the second mounting groove, and a longitudinal width of the inner plate is less than a longitudinal width of the second mounting groove; a width difference between the inner plate and the second mounting groove is equal to a thickness of the fourth transverse plate plus a mounting margin; the fourth transverse plate is parallel to the lower cutting table and is disposed in a gap between the inner plate and the second mounting groove; and a depth of the second mounting groove is equal to a width of the fourth transverse plate.
6. The device of claim 1, wherein bottom ends of the plurality of support plates are flush with a bottom end of the inner plate, and each of the bottom ends of the plurality of support plates comprises a right-angle groove for fitting and approaching the plurality of support plates to the second mounting groove of the lower cutting table; top ends of the plurality of support plates are flush with a top end of the inner plate, and the plurality of support plates abut at intervals against an outer wall of the inner plate....

Claims

What is claimed is:
1. An outer rotor of a motor, the outer rotor comprising: an annular rotor core and a plurality of permanent magnets; wherein the annular rotor core comprises a central hole; the annular rotor core further comprises a plurality of slots, and the plurality of permanent magnets are disposed in the plurality of slots and form a plurality of magnetic poles along a circumferential direction of the rotor core;
each magnetic pole comprises three shapes of permanent magnet: a first arc-shaped permanent magnet concentric with the rotor core and having a uniform thickness, a second arc-shaped permanent magnet not concentric with the rotor core, and a rectangular permanent magnet;
in each magnetic pole, the three shapes of permanent magnet are symmetrically arranged along a center line L of the magnetic pole, and the first arc-shaped permanent magnet, the second arc-shaped permanent magnet and the rectangular permanent magnet are sequentially spaced radially from inside to outside;
an inner arc-shaped surface of the first arc-shaped permanent magnet and an inner circular sidewall of the rotor core are of equal radius and form a flush structure;
one magnetic pole comprises at least three first arc-shaped permanent magnets, one second arc-shaped permanent magnet, and two rectangular permanent magnets; the at least three first arc-shaped permanent magnets are arranged at intervals along the circumferential direction of the rotor core, and a magnetic channel is formed between every two adjacent first arc-shaped permanent magnets;
the second arc-shaped permanent magnet is located between the at least three first arc-shaped permanent magnets and the rectangular permanent magnet, and the second arc-shaped permanent magnet is not in contact with the inner circular sidewall and outer circular sidewall of the rotor core; and an inner arc surface of the second arc-shaped permanent magnet covers at least one first arc-shaped permanent magnet and at least two magnetic channels.
2. The outer rotor of claim 1, wherein each magnetic pole has a central angle α3, α3=360°/2P, where P is a number of pairs of the magnetic poles on the rotor core; 1.5*α3>α1>0.5*α3, and 1.5*α3<α2<3*α3, where α1 is an included angle between the center line L of the magnetic pole and the rectangular permanent magnet, and α2 is a central angle of the second arc-shaped permanent magnet.
3. The outer rotor of claim 2, wherein the included angle α1 between the center line L of the magnetic pole and the rectangular permanent magnet is less than 90°, and the central angle α2 of the second arc-shaped permanent magnet is 45°<α2<180°.
4. The outer rotor of claim 3, wherein the first arc-shaped permanent magnets are three or four in number.
5. The outer rotor of claim 4, wherein the first arc-shaped permanent magnets have a thickness d, and the rotor core has a thickness D, where 0.16*D6. The outer rotor of claim 5, wherein a minimum distance between the second arc-shaped permanent magnet and the outer circular sidewall of the rotor core is L2, and 0.15*D7. The outer rotor of claim 6, wherein a minimum distance between the rectangular permanent magnet and the second arc-shaped permanent magnet is L3, and 0.15*D8. The outer rotor of claim 7, wherein the rotor core further comprises first auxiliary slots on both ends of the rectangular permanent magnet; a first narrow magnetic bridge is formed between one first auxiliary slot and the outer circular sidewall to reduce magnetic leakage; the rotor core further comprises second auxiliary slots on both ends of the second arc-shaped permanent magnet; a second narrow magnetic bridge is formed between one second auxiliary slot and an outer arc surface of the first arc-shaped permanent magnets to reduce magnetic leakage; and both the first auxiliary slots and the second auxiliary slots are filled with non-magnetic permeable materials.
9. The outer rotor of claim 8, wherein the second arc-shaped permanent magnet has a uniform thickness or is thick in the middle and thin at both ends.
10. The outer rotor of claim 8, wherein the first arc-shaped permanent magnet, the second arc-shaped permanent magnet, and the rectangular permanent magnet all comprise ferrite material; or, the first arc-shaped permanent magnet comprises neodymium iron boron material, and the second arc-shaped permanent magnet and the rectangular permanent magnet both comprise ferrite material.
11. A permanent magnet synchronous motor, comprising a stator assembly and the outer rotor of claim 1....

Claims

What is claimed is:
1. A method, comprising:
(1) collecting a plurality of activated sludge samples, acquiring raw data of images of the plurality of activated sludge samples, cleaning the raw data of the images, and standardizing data sizes of the images;
(2) calculating a sludge volume index (SVI) for each of the plurality of activated sludge samples;
(3) establishing, by using a ResNet50 deep neural network, a model for predicting the settleability of activated sludge; and
(4) predicting the settleability of a target activated sludge using the model established in (3);
wherein, (3) is implemented as follows:
(301) separating, by using the sludge volume index for each of the plurality of activated sludge samples obtained in (2), the plurality of activated sludge samples into a bulking sample set and a non-bulking sample set;
(302) augmenting the bulking sample set or the non-bulking sample set, to equalize the sample sizes between the bulking sample set and the non-bulking sample set;
(303) dividing a dataset for establishing the model into a training set, a validation set, and a testing set, and optimizing hyperparameters of the model;
(304) selecting optimal hyperparameters of the model, training the model to predict the settleability of activated sludge, and assessing a classification performance of the model using the testing set.
2. The method of claim 1, wherein in (1), the raw data of the images of the plurality of activated sludge samples are acquired using a high-throughput image acquisition system, and the raw data of the images is cleaned by removing blurry images and erroneous samples.
3. The method of claim 1, wherein in (2), for each of the plurality of activated sludge samples, the sludge volume index (SVI) is calculated using experimentally determined settled sludge volume (SV) and mixed liquor suspended solids (MILSS) concentration, following a calculation formula:
SVI
⁡
(
mL
·
g
-
1
)
=
S
⁢
V
⁡
(
mL
·
L
-
1
)
MLSS
⁡
(
g
·
L
-
1
)
.
4. The method of claim 1, wherein in (301), a threshold for SVI is defined; when the SVI of the activated sludge falls below the SVI threshold, the activated sludge sample is classified as bulking; otherwise, the activated sludge sample is classified as non-bulking; and the SVI threshold is set within the range of 150 to 190 mL·g−1.
5. The method of claim 1, wherein in (302), the augmenting comprises separately rotating the images by 90°, 180°, and 270° for the bulking sample set or the non-bulking sample set.
6. The method of claim 1, wherein in (303), the dataset is split into the training set and the testing set in proportion; during model training process, the training set is further automatically split into an operational training set and a validation set.
7. The method of claim 1, wherein in (303), the hyperparameters of the model are optimized; the hyperparameters comprise an optimizer and a learning rate; the optimizer is stochastic gradient descent; and the learning rate is optimized using a ReduceLROnPlateau callback function, thereby improving a speed of network convergence during training.
8. The method of claim 1, wherein in (304), while training the model to predict the settleability of activated sludge, a loss is calculated using a cross-entropy loss function.
9. The method of claim 1, wherein in (304), when assessing the classification performance of the model using the testing set, four metrics—Accuracy, Precision, Recall, and F1 score are used to measure and analyze classification capabilities of the model; the formula for calculating Accuracy is as follows:
Accuracy
⁢
=
T
⁢
P
+
T
⁢
N
T
⁢
P
+
F
⁢
P
+
T
⁢
N
+
F
⁢
N
;
the formula for calculating Precision is as follows:
Precision
⁢
=
T
⁢
P
T
⁢
P
+
F
⁢
P
the formula for calculating Recall is as follows:
Recall
=
T
⁢
P
T
⁢
P
+
F
⁢
N
the formula for calculating F1 score is as follows:
F
⁢
1
⁢
Score
=
2
×
precision
×
recall
precision
+
recall
;
where TP represents true positives, indicating instances where actual positive samples are correctly predicted as positive; TN represents true negatives, indicating instances where actual negative samples are correctly predicted as negative; FP represents false positives, indicating instances where actual negative samples are incorrectly predicted as positive; FN represents false negatives, indicating instances where actual positive samples are incorrectly predicted as negative.
10. The method of claim 1, wherein (4) is implemented as follows:
(401) collecting a plurality of activated sludge samples to be tested; and acquiring, by using a high-throughput image acquisition system, image data of the plurality of activated sludge sample to be tested;
(402) automatically standardizing the data sizes of the images for the plurality of activated sludge sample to be tested; and
(403) inputting standardized image data of the plurality of activated sludge samples to be tested into the model, generating operational output results, and thereby determining whether the tested activated sludge samples have undergone bulking....

Claims

What is claimed is:
1. A crystalline form B of a 2-(2,4,5-substituted phenylamino) pyrimidine derivative of formula I:
wherein a CuKα-X-ray powder diffraction (XRPD) spectrum of the crystalline form B comprises diffraction peaks at diffraction angle 2θ positions of 8.55°±0.2°, 9.47°±0.2°, 10.31°±0.2°, 12.65°±0.2°, 14.47°±0.2°, 15.17°±0.2°, 15.61°±0.2°, 16.29°±0.2°, 17.07°±0.2°, 17.31°±0.2°, 17.73°±0.2°, 18.22°±0.2°, 18.74°±0.2°, 19.47°±0.2°, 19.70°±0.2°, 20.24°±0.2°, 20.72°±0.2°, 21.68°±0.2°, 22.08°±0.2°, 22.80°±0.2°, 23.50°±0.2°, 23.99°±0.2°, 24.20°±0.2°, 24.83±0.2°, 25.65°±0.2°, 26.15±0.2°, 26.99°±0.2°, 27.69°±0.2°, 28.30°±0.2°, 29.57°±0.2°, 30.74°±0.2°, and 32.58°±0.2°.
2. A method of treatment of non-small cell lung cancer, the method comprising administering to a patient in need thereof an effective amount of the crystalline form B of the 2-(2,4,5-substituted phenylamino) pyrimidine derivative of claim 1.
3. The method of claim 2, wherein the method further comprises administering to the patient another lung cancer therapeutic drug....

Claims

What is claimed is:
1. A device, comprising:
a housing;
a plurality of supporting rods;
a roof plate;
a mixing room;
a lifting mechanism;
a stirring mechanism;
a control mechanism comprising a first conductive block and a second conductive block;
a driving mechanism; and
a cleaning mechanism;
wherein:
the housing comprises a top end and one end of each of the plurality of supporting rods is disposed on the top end, and the roof plate is disposed on the other end of each of the plurality of supporting rods;
the stirring mechanism is fixed on the roof plate;
the mixing room comprises a bottom wall and the housing comprises an inner bottom surface; the mixing room comprises a discharge port disposed on the bottom wall, and a seal plug disposed in the discharge port;
the lifting mechanism is disposed between the bottom wall and the inner bottom surface and an outer sidewall of the mixing room abuts against an inner sidewall of the housing;
the cleaning mechanism is disposed over the stirring mechanism;
the stirring mechanism comprises a stirring part and a rotating rod; the stirring part extends into the mixing room and the rotating rod is configured to move the first conductive block to abut against the second conductive block; and
the control mechanism is electrically connected to the stirring mechanism and the driving mechanism.
2. The device of claim 1, wherein the stirring mechanism comprises a rotating shaft, a plurality of stirring rods, and a driving member; the rotating shaft is flexibly connected through a first bearing to the roof plate; the rotating shaft is connected to the driving member via a transmission; and the plurality of stirring rods is disposed on two sides of the rotating shaft.
3. The device of claim 2, wherein the driving member comprises a motor, a driving wheel, and a driven wheel; the motor is fixed on the roof plate; an output terminal of the motor is connected to the driving wheel; the driven wheel is connected to the rotating shaft; and the driving wheel is engaged with the driven wheel.
4. The device of claim 2, wherein the cleaning mechanism comprises a U-shaped rod, four cleaning members, and a plurality of fixing rods; the driving mechanism comprises a movable end and the U-shaped rod is fixedly connected to the movable end; the U-shaped rod comprises a bottom end and the plurality of fixing rods are fixedly connected to the bottom end; and the four cleaning members are fixedly connected to the plurality of fixing rods and are divided into two groups opposite to each other to clean the plurality of stirring rods on two sides of the rotating shaft, respectively.
5. The device of claim 4, wherein the driving mechanism comprises a frame, a drive motor, a leadscrew, and a threaded sleeve; the frame comprises a lower portion and the drive motor is disposed on the lower portion; an output of the drive motor is connected to the leadscrew; the leadscrew comprises a distal end away from the drive motor and the distal end is connected through a second bearing to an upper portion of the frame; and the threaded sleeve is disposed around the leadscrew and is connected to the U-shaped rod via a connection rod.
6. The device of claim 1, wherein the lifting mechanism comprises a first controller and a telescopic cylinder; the first controller comprises a switch button and is electrically connected to the telescopic cylinder; and an output end of the telescopic cylinder is fixedly connected to the bottom wall of the mixing room.
7. The device of claim 1, wherein the control mechanism further comprises a controller and a power supply; the first conductive block is movable and is connected to the rotating rod; the second conductive block is immovable and abuts adapted to be abut against the first conductive block; the first conductive block and the power supply are electrically connected to the controller; and the second conductive block is electrically connected to the power supply.
8. The device of claim 7, wherein when the first conductive block abuts against the second conductive block, the controller is powered on by the power supply....

Claims

The invention claimed is:
1. A punching bag, comprising:
a main body module; and
a plurality of digital display modules;
wherein:
the main body module is a modularized body for boxing training, and comprises a cylinder body, a pillar, and a flange;
the cylinder body comprises a first member and a second member;
the first member comprises an upper part and a lower part integrated with the upper part; the upper part is cylindrical and the lower part is semicylindrical; the upper part comprises a central axial hole; the lower part comprises a first rectangular surface and a first axial semicircular groove disposed in a middle of the first rectangular surface; the first axial semicircular groove extends to communicate with the central axial hole of the upper part; diameters of the first axial semicircular groove and the central axial hole correspond to a diameter of the pillar;
the second member is semicylindrical, and comprises a second rectangular surface and a second axial semicircular groove disposed in a middle of the second rectangular surface; a diameter of the second axial semicircular groove corresponds to the diameter of the pillar;
the first member is in embedded connection to the second member to form the cylinder body; the first axial semicircular groove cooperates with the second axial semicircular groove to form an axial hole to receive the pillar;
the cylinder body is supported by the flange and locked by the pillar;
the main body module further comprises a buffer layer and an outer layer; the buffer layer is disposed between the cylinder body and the outer layer; a counterweight base is fixed on one end of the pillar; the buffer layer comprises a plurality of grooves, and the plurality of digital display modules are embedded in the plurality of grooves, respectively; and
each of the plurality of digital display modules comprise a touchscreen cover, a chip, a base plate, a light-emitting diode, and a pressure sensor; the chip comprises a front side and a back side, and the light-emitting diode is disposed on the front side and the pressure sensor is disposed on the back side; the touchscreen cover comprises a curved outer surface and translucent resilience material; the touchscreen cover further comprises a thickened center part comprising a plurality of dents; the touchscreen cover is attached to the base plate through an adhesive; the chip is connected to the digital control panel through a lead wire; an adapter sleeve is disposed on a back side of the digital control panel and sleeves the pillar.
2. The punching bag of claim 1, wherein the pressure sensor is a three-contact structure; a joint of the chip and the touchscreen cover and four contact corners of the chip and the base plate are provided with locating holes and locating pins; and a reinforcing rib is disposed on a back side of the base plate.
3. The punching bag of claim 1, wherein the cylinder body is a molded resilient structure or a container structure comprising a filler; the container structure is blow molded; the first member comprises a first top end comprising a first filling opening; and the second member comprises a second top end comprising a second filling opening.
4. The punching bag of claim 1, wherein an embedded part is disposed on an outer surface of a joint of the first member and the second member; the embedded part is a concave platform comprising connecting holes; and screws pass through the connecting holes to fixedly connect the first member and the second member.
5. The punching bag of claim 3, wherein a recess is disposed on a bottom of the upper part of the first member, and the second filling opening of the second member is located in the recess; and a vertical height ratio of the first member to the second member is 2:1.
6. The punching bag of claim 1, wherein a fixed bar and a non-skid tape are disposed on the pillar; the fixed bar is disposed at a lower part of a top end of the pillar, and the top end of the pillar is embedded in the central axial hole; and two ends of the fixed bar are disposed on a top side of the first rectangular surface of the first member....

Claims

What is claimed is:
1. An aryl sulfide of formula I, or an agriculturally acceptable salt thereof,
wherein:
n is 0 or 1;
X is fluorine, chlorine, or methyl;
Y is chlorine or methyl;
R1 is hydrogen, fluorine, chlorine, bromine, hydroxyl, nitro, hydroxymethyl, a cyano group, trifluoromethyl, C1-3 alkyl, C1-4 alkoxycarbonyl, acetyl, propionyl, C1-3 alkoxy, ethylthio, 2-fluoroethanothioxy, 2-chloroethanothioxy, 2,2-difluoroethylthio, 2,2,2-trifluoroethylthio, propylthio, 2,2,2-trifluoroethylsulfinyl, vinyloxycarbonyl, 2,2,2-trifluoroethoxycarbonyl, or n-methylcarbonyl;
R2 is hydrogen, fluorine, or chlorine;
R3 is hydrogen, fluorine, chlorine, bromine, or a cyano group;
R4 and R5 at each occurrence represent hydrogen; and
R6 is n-propyl or 2,2,2-trifluoroethyl.
2. The aryl sulfide of claim 1, wherein
n is 0 or 1;
X is fluorine;
Y is chlorine or methyl;
R1 is methoxycarbonyl, ethoxycarbonyl, ethylthio, or 2,2,2-trifluoroethylthio;
R2, R4, and R5 at each occurrence represent hydrogen;
R3 is hydrogen, fluorine, chlorine, or a cyano group; and
R6 is 2,2,2-trifluoroethyl.
3. The aryl sulfide of claim 1, wherein the aryl sulfide is:...

Claims

What is claimed is:
1. A rolling mechanism for grain refinement of a metal rod, comprising two main rolls and two auxiliary rolls; wherein:
the two main rolls are opposite to each other and the two auxiliary rolls are opposite to each other, and the two main rolls and the two auxiliary rolls are disposed around a rolling line to form a nip zone where a billet is rolled into the metal rod;
in any cross section of the nip zone with the rolling line as a normal line, a first line connecting central axes of the two main rolls is perpendicular to a second line connecting central axes of the two auxiliary rolls;
each main roll comprises a first protrusion portion, a first end portion and a second end portion; the first end portion and the second end portion are disposed opposite each other along a corresponding roll axis; the first end portion has a smaller diameter than the second end portion; the first protrusion portion is disposed between the first end portion and the second end portion;
each auxiliary roll comprises a second protrusion portion, a third end portion and a fourth end portion; the third end portion and the fourth end portion are disposed opposite each other along a corresponding roll axis; the third end portion has a smaller diameter than the fourth end portion; the second protrusion portion is disposed between the third end portion and the fourth end portion; and
the first protrusion portion has a greater diameter than the second protrusion portion; a narrow space of the nip zone is surrounded by the two first protrusion portions of the two main rolls and the two second protrusion portions of the two auxiliary rolls; the first end portion is disposed adjacent to the fourth end portion; and the second end portion is disposed adjacent to the third end portion.
2. The rolling mechanism of claim 1, wherein
a ratio of a length of the first line to a length of the second line is a constant ranging from 1-1.1; and/or
the two main rolls and the two auxiliary rolls have the same length; the first protrusion portion is disposed on a midpoint of a first axis from the first end portion to the second end portion; and the second protrusion portion is disposed on a midpoint of a second axis from the third end portion to the fourth end portion.
3. The rolling mechanism of claim 1, wherein:
the two main rolls and the two auxiliary rolls separately comprise at least three truncated cones arranged along a corresponding roll axis; each truncated cone comprises a top surface and a base surface; every two adjacent truncated cones are connected by attaching the top surface to an adjacent base surface; the top surface has the same diameter as the adjacent base surface; and
at least two of the at least three truncated cones of each main roll are disposed between the first protrusion portion and the second end portion, and at least two of the at least three truncated cones of each auxiliary roll are disposed between the second protrusion portion and the fourth end portion.
4. The rolling mechanism of claim 3, wherein each truncated cone has a roll surface angle ranging from 2.5° to 5°.
5. The rolling mechanism of claim 3, wherein
the at least three truncated cones of each main roll comprise a first truncated cone and a second truncated cone arranged from the first end portion to the second end portion; the first protrusion portion is formed between the first truncated cone and the second truncated cone; and
the at least three truncated cones of each auxiliary roll comprise a third truncated cone and a fourth truncated cone arranged from the third end portion to the fourth end portion; the second protrusion portion is formed between the third truncated cone and the fourth truncated cone.
6. The rolling mechanism of claim 5, wherein
a ratio of a length of each main roll to a diameter of the first protrusion portion ranges from 3 to 7; and/or a ratio of a diameter of the first protrusion portion to a diameter of the second protrusion portion ranges from 1 to 2.
7. A method for rolling an ultra-fine-grained M50NiL rod by using the rolling mechanism of claim 1, the method comprising:
S1. preparing an M50NiL rod with a diameter ranging from 220 mm to 350 mm as a billet;
S2. heating the billet within a preset time at a preset temperature;
S3. feeding the billet into the rolling mechanism to obtain a semi-finished product; and
S4. cooling the semi-finished product to obtain the ultra-fine-grained M50NiL rod;
wherein
an entry angle of the rolling mechanism ranges from 10° to 13°; and a nip angle of the rolling mechanism ranges from 7° to 10°.
8. The method of claim 7, wherein S3 further comprises: S3-1: feeding the heated billet through a feed inlet adjacent to the two second end portions into the nip zone for rolling, and forcing the semi-finished product to move through a feed outlet adjacent to the two fourth end portions.
9. The method of claim 8, wherein
the two main rolls have the same shape as the two auxiliary rolls; the two main rolls and the two auxiliary rolls separately comprise at least three truncated cones arranged along a corresponding roll axis; at least two of the at least three truncated cones of each main roll are disposed between the first protrusion portion and the second end portion, and at least two of the at least three truncated cones of each auxiliary roll are disposed between the second protrusion portion and the fourth end portion; for each main roll, a first truncated cone and a second truncated cone among the at least three truncated cones of the main roll are arranged from the first end portion to the second end portion; the first protrusion portion is formed between the first truncated cone and the second truncated cone; for each auxiliary roll, a third truncated cone and a fourth truncated cone among the at least three truncated cones of the auxiliary roll are arranged from the third end portion to the fourth end portion; the second protrusion portion is formed between the third truncated cone and the fourth truncated cone; distances between the two main rolls and between the two auxiliary rolls are adjustable; and S3 further comprises:
S3-2. adjusting the distances between the two main rolls and between the two auxiliary rolls; either feeding the heated billet through the feed inlet adjacent to the two second end portions into the nip zone for rolling and forcing the semi-finished product to move through the feed outlet adjacent to the two fourth end portions, or feeding the heated billet through a feed inlet adjacent to the two fourth end portions into the nip zone for rolling and forcing the semi-finished product to move through a feed outlet adjacent to the two second end portions; and
S3-3. repeating S3-2.
10. The method of claim 9, wherein the two main rolls and the two auxiliary rolls rotate at a speed ranging from 11 r/min to 13 r/min.
11. The method of claim 7, wherein a ratio of a diameter of the first protrusion portion to a diameter of the billet ranges from 1 to 5....

Claims

CLAIM
1. The ornamental design for an electronic hookah as shown and described....

Claims

What is claimed is:
1. A travel pillow, comprising:
a mounting assembly; and
a main body comprising a U-shaped case detachably connected to the mounting assembly;
wherein:
the mounting assembly comprises a cover, a U-shaped filler, and an inner frame; the cover, the U-shaped filler, and the inner frame are disposed sequentially from outside to inside; and the U-shaped filler is detachably attached to the U-shaped case;
the inner frame comprises an arc-shaped support body and two arms;
two ends of the arc-shaped support body comprise two first knuckles, respectively; and the travel pillow further comprises two rotary connectors connected to the two first knuckles, respectively;
each arm comprises a second knuckle; the first knuckle comprises a through hole; each rotary connector comprises a rotating shaft and a nut;
the rotating shaft comprises a threaded end and a rotating part;
the threaded end is in threaded connection to the nut; and the rotating shaft is disposed in the through hole;
the first knuckle is disposed between the nut and the second knuckle;
and the rotating part is disposed in the second knuckle; and
the two arms are rotatably disposed on both ends of the arc-shaped support body, respectively; and an included angle between the arc-shaped support body and each arm is adjustable.
2. The travel pillow of claim 1, wherein the mounting assembly is U-shaped and comprises an inner surface in contact with the U-shaped case; and the U-shaped case comprises an outer surface fitting in with the inner surface.
3. The travel pillow of claim 1, wherein the cover comprises an arc-shaped middle and two end parts; and the two end parts are formed integrally with or detachably connected to the arc-shaped middle.
4. The travel pillow of claim 1, wherein the U-shaped filler is detachably connected to the U-shaped case through a zipper; and the U-shaped filler comprises silicone or rubber.
5. The travel pillow of claim 1, wherein the U-shaped filler comprises a first groove; the arc-shaped support body comprises a first protrusion; and the first groove is detachably connected to the first protrusion.
6. The travel pillow of claim 5, wherein the U-shaped filler further comprises a second groove; each of the two arms comprises a second protrusion; and the second protrusion is detachably disposed in the second groove....

Claims

What is claimed is:
1. A travel pillow, comprising:
a main body;
a rotary frame disposed on an outer side of the main body; and
a casing detachably disposed on an outer side of the rotary frame;
wherein:
the rotary frame comprises a support arm, a rear support part, and an angle adjustment assembly; the support arm is rotatably connected to the rear support part, and the angle adjustment assembly is disposed between the support arm and the rear support part to adjust an angle between the support arm and the rear support part;
the angle adjustment assembly comprises a rotating shaft and a damper; the damper sleeves one end of the rotating shaft; the damper comprises a first fixing part and an adjustment end; the adjustment end comprises a plurality of adjustment sections disposed at equal intervals around the rotating shaft; each of the adjustment sections comprises a first adjustment section and a second adjustment section; the first adjustment section is closer to the first fixing part than the second adjustment section; and the first adjustment section has a greater outer diameter than the second adjustment section;
the support arm comprises a first socket ring, and the rear support part comprises a second socket ring; the first socket ring is connected to the support arm and sleeves the rotating shaft; and the second socket ring is connected to the rear support part and sleeves the rotating shaft; and
the rotating shaft comprises a second fixing part and a damping part which are disposed on both ends of the rotating shaft, respectively; the damper is detachably disposed around the damping part so as to rotate around the damping part; and the second fixing part comprises an external thread matched with a threaded nut.
2. The travel pillow of claim 1, wherein the damper further comprises a damping cover comprising an internal thread; and the first fixing part comprises an external thread matched with the internal thread.
3. The travel pillow of claim 1, wherein the second fixing part has an irregular shape; the second socket ring comprises a connection part matched with the second fixing part in shape; and the connection part sleeves the second fixing part.
4. The travel pillow of claim 1, wherein the second socket ring further comprises a first ring part and a second ring part; the rotating shaft is inserted through the second ring part, the first socket ring, and the second ring part successively, and is fixedly disposed to prevent the first socket ring from sliding off the rotating shaft.
5. The travel pillow of claim 1, wherein the travel pillow comprises a filler disposed between the rotary frame and the casing; and the filler comprises silicone....

Claims

CLAIM
1. The ornamental design for a storage shelf as shown and described....

Claims

What is claimed is:
1. A bioretention pond for rainwater treatment, comprising:
a pond body; and
an overflow weir;
wherein:
the pond body comprises a pond wall and a layered substrate;
the layered substrate comprises from bottom to top: a gravel layer, a transition layer, a pyrite layer, a plant layer, a pebble layer, an organic layer, and a water storage layer;
the overflow weir is disposed on the pebble layer with a space left above a center of the pebble layer;
the organic layer is disposed in the space and covers the pebble layer;
the water storage layer is disposed onto the organic layer; and
the pond body further comprises a perforated pipe, and one end of the perforated pipe is disposed in the gravel layer; and the perforated pipe comprises an outlet end which is flush with a top part of the pyrite layer.
2. The bioretention pond of claim 1, wherein the overflow weir comprises a plurality of outer plates and a plurality of inner plates, and a channel is formed by the plurality of outer plates and the plurality of inner plates; the plurality of outer plates is fixedly disposed on the pond wall; each of the plurality of inner plates comprises a first upper end and a first lower end, both of which comprises at least one telescoping pole; each of the plurality of outer plates comprises a second upper end and a second lower end, both of which comprises at least one threaded hole; the at least one telescoping pole comprises a threaded end connected to the at least one corresponding threaded hole.
3. The bioretention pond of claim 2, wherein one end of each of the plurality of inner plate comprises at least one hook; the other end of each of the plurality of inner plate comprises at least one groove; the at least one hook is latched on a corresponding at least one groove, so that every two adjacent inner plates are connected to each other.
4. The bioretention pond of claim 3, wherein the pond body further comprises an overflow pipe; the overflow pipe comprises an inlet end, and outlet end, two straight sections, and a 90 degree elbow; the two straight sections are connected to each other by the 90 degree elbow; one of the two straight sections is disposed in the plant layer; the other one of the two straight sections extends upward through the organic layer with the inlet end exposed to the water storage layer; and the outlet end is connected to a rainwater pipeline.
5. The bioretention pond of claim 4, wherein the bioretention pond for rainwater treatment further comprises a gravel drainage ditch disposed around the pond body; the gravel drainage ditch comprises a distal side and a proximal side lower than the distal side; the distal side is away from the pond wall, and the proximal side is near the pond wall; the overflow weir is covered with a filter plate; and at least one plant is planted on the plant layer.
6. The bioretention pond of claim 5, wherein the organic layer is an agricultural material comprising bark, sawdust, coconut husk, and corn cob; the agricultural material has a particle size of greater than 2 cm; and the organic layer has a thickness of 5-10 cm.
7. The bioretention pond of claim 6, wherein the pebble layer has a thickness of 5-10 cm and comprises pebbles with a particle size that is greater than 2 cm and less than the particle size of the agricultural material.
8. The bioretention pond of claim 7, wherein the plant layer comprises quartz sand and sandy loam mixed in a volume ratio of (14-17):(3-6); water flows through the plant layer at a seepage velocity of more than or equal to 150 mm/h; and the plant layer has a thickness of more than or equal to 30 cm.
9. The bioretention pond of claim 8, wherein the pyrite layer comprises quartz sand and pyrite mixed in a volume ratio of (6-8):(4-2); water flows through the pyrite layer at a seepage velocity of 250-350 mm/h; and the pyrite layer has a thickness of 20-50 cm....

Claims

What is claimed is:
1. A method for controlling operation of a permanent-magnet synchronous motor through sensorless vector control, the method comprising:
during operation of the permanent-magnet synchronous motor, receiving, by the permanent-magnet synchronous motor, a shutdown signal from an external device;
uninterruptedly outputting, by a microcontroller unit (MCU), a deceleration pulse to an inverter, instead of directly blocking a PWM pulse to the inverter, and constantly monitoring a control signal sent by the external device;
during a deceleration process, when the MCU receives a new startup signal and a real-time speed Vi of the permanent-magnet synchronous motor is greater than or equal to a reference speed Vref, controlling the permanent-magnet synchronous motor to rotate at a parameter approaching to a target torque T or a target speed V corresponding to the new startup signal from the real-time speed Vi;
blocking, by the MCU, the PWM pulse when the real-time speed Vi of the permanent-magnet synchronous motor is lower than the reference speed Vref;
wherein when the MCU blocks the PWM pulse, the permanent-magnet synchronous motor continues rotating due to inertia, and the control signal sent by the external device is constantly monitored; if, at this stage, the MCU receives another new startup signal, all lower bridge switch transistors are activated, causing the permanent-magnet synchronous motor to enter a dynamic braking mode for a duration t1; the MCU gives commands to input currents to the phase windings sequentially to lock a rotor position for a duration t2; and the permanent-magnet synchronous motor reenters into a sensorless startup state according to the new startup signal; and
wherein the permanent-magnet synchronous motor is a three-phase permanent-magnet synchronous motor with a three-phase winding comprising three sets of coils U, V, W; when the MCU blocks the PWM pulse and the MCU receives the new startup signal, three lower bridge switch transistors Q4, Q5, and Q6 are activated, causing the permanent-magnet synchronous motor to enter the dynamic braking mode for the duration t1; and the MCU gives commands to input currents to the three sets of coils U, V, and W sequentially to lock the rotor position for the duration t2.
2. The method of claim 1, wherein when the motor receives the shutdown signal from the external device, the MCU controls the motor to decelerate; when the shutdown signal exceeds or equals a set time duration t3, the MCU blocks the PWM pulses.
3. The method of claim 1, wherein the reference speed Vref is in the range of 200 to 400 rpm.
4. The method of claim 1, wherein the permanent-magnet synchronous motor rotates at the parameter approaching to the target speed V corresponding to the new startup signal from the real-time speed Vi with a step size V0 increasingly or decreasingly.
5. The method of claim 4, wherein the step size V0 is determined based on the rotational inertia and a difference between the real-time speed Vi and the target speed V corresponding to an acquired tap position signal....

Claims

What is claimed is:
1. A motor controller, comprising: a tap position selection circuit, a micro control unit (MCU), and an inverter circuit;
wherein:
the tap position selection circuit is configured to process a plurality of tap position signals transmit processed tap position signals to the MCU;
the MCU is configured to output signals to control the operation of the inverter circuit;
the inverter circuit comprises an output terminal connected to a plurality of coil windings of a stator module of a motor;
the tap position selection circuit comprises a plurality of first signal input circuits for motor start and a plurality of second signal input circuits for motor stop;
each tap position signal M is split into a first part and a second part; the first part is input into one first signal input circuit for motor start and the second part is input into one second signal input circuit for motor stop; and
the first signal input circuit for motor start and the second signal input circuit for motor stop output two level signals, IO-a and IO-b, respectively, to the MCU, and the MCU controls a start or stop state of the motor based on a magnitude of the two level signals, IO-a and IO-b.
2. The motor controller of claim 1, wherein the first signal input circuit for motor start has a first threshold voltage U1, and the second signal input circuit for motor stop has a second threshold voltage U2; a potential difference is present between the first threshold voltage U1 and the second threshold voltage U2; when a voltage of the tap position signal M is greater than the first threshold voltage U1, the level signal IO-a is high-level; when the voltage of the tap position signal M is less than the first threshold voltage U1, the level signal IO-a is low-level; similarly, when the voltage of the tap position signal M is greater than the second threshold voltage U2, the level signal IO-b is high-level, and when the voltage value of the tap position signal M is less than the second threshold voltage U2, the level signal IO-b is low-level.
3. The motor controller of claim 2, wherein the first signal input circuit for motor start comprises a resistor R3, a capacitor C5, a diode D1, a voltage regulator ZD1, a transistor Q1, an optocoupler chip U10, a capacitor C1, and a resistor R2; the tap position signal M is transmitted to a first input pin 1a of the optocoupler chip U10; the transistor Q1 comprises a first collector, a first emitter, and a first base; the first collector of the transistor Q1 is connected to a second input pin 2a of the optocoupler chip U10, and the first emitter of the transistor Q1 is grounded; one end of the resistor R3 is in series with one end of the voltage regulator ZD1, and the other end of the voltage regulator ZD1 is connected to the first base of the transistor Q1; the other end of the resistor R3 is in series with one end of the voltage regulator ZD1, and the other end of the voltage regulator ZD1 is connected to one end of the capacitor C5; the other end of the capacitor C5 is grounded; the tap position signal M is transmitted to the one end of the capacitor C5 through the diode D1; the capacitor C1 and the resistor R2 are connected in parallel; one end of a parallel combination of the capacitor C1 and the resistor R2 is connected to an output pin 3a of the optocoupler chip U10, and the other end of the parallel combination is grounded.
4. The motor controller of claim 3, wherein a magnitude of the first threshold voltage U1 is determined by the resistor R3 and the voltage regulator ZD1; when the diode D1 receives the tap position signal M, the capacitor C5 is charged; when a terminal voltage of the capacitor C5 exceeds the first threshold voltage U1, the transistor Q1 switches on, so that a connection among the first input pin 1a of the optocoupler chip U10, the second input pin 2a of the optocoupler chip U10, and the transistor Q1 is established, allowing the optocoupler chip U10 to output the level signal IO-a at high state; when the terminal voltage of the capacitor C5 is lower than the first threshold voltage U1, the transistor Q1 switches off, and no connection is established among the first input pin 1a of the optocoupler chip U10, the second input pin 2a of the optocoupler chip U10, and the transistor Q1; as a result, the optocoupler chip U10 outputs the level signal IO-a at low state.
5. The motor controller of claim 4, wherein the second signal input circuit for motor stop comprises a resistor R10, a capacitor C6, a diode D3, a voltage regulator ZD2, a transistor Q2, an optocoupler chip U20, a capacitor C3, and a resistor R9; the tap position signal M is transmitted to the first input pin 1b of the optocoupler chip U20; the transistor Q2 comprises a second collector, a second emitter, and a second base; the second collector of the transistor Q2 is connected to the second input pin 2b of the optocoupler chip U20, and the second emitter of the transistor Q2 is grounded; one end of the resistor R10 is in series with one end of the voltage regulator ZD2, and the other end of the voltage regulator ZD2 is connected to the second base of the transistor Q2; the other end of the resistor R10 is connected to one end of the capacitor C6, and the other end of the capacitor C6 is grounded; the tap position signal M is transmitted to the one end of the capacitor C6 through the diode D3; the capacitor C3 and the resistor R9 are connected in parallel; one end of the parallel combination is connected to the output pin 3b of the optocoupler chip U20, and the other end of the parallel combination is grounded.
6. The motor controller of claim 5, wherein a magnitude of the second threshold voltage U2 is determined by the resistor R10 and the voltage regulator ZD2; when the diode D3 receives the tap position signal M, the capacitor C6 is charged; when a terminal voltage of the capacitor C6 exceeds the second threshold voltage U2, the transistor Q2 switches on, so that a connection among the first input pin 1b of the optocoupler chip U20, the second input pin 2b of the optocoupler chip U20, and the transistor Q2 is established, allowing the optocoupler chip U20 to output the level signal IO-b at high state; when the terminal voltage of the capacitor C6 is lower than the second threshold voltage U2, the transistor Q2 switches off, and no connection is established among the first input pin 1b of the optocoupler chip U20, the second input pin 2b of the optocoupler chip U20, and the transistor Q2; as a result, the optocoupler chip U20 outputs the level signal IO-b at low state.
7. The motor controller of claim 6, wherein the first threshold voltage U1 is greater than the second threshold voltage U2.
8. The motor controller of claim 7, wherein the plurality of tap position signals comprise two tap position signals, M1 and M2.
9. A brushless direct current (BLDC) motor, comprising a motor and the motor controller of claim 1, and the motor comprising a stator, a rotor, and a housing....

Claims

What is claimed is:
1. An acceleration sensor, comprising:
an upper base plate;
a lower base plate; and
a gallium-based liquid metal encapsulated in graphene;
wherein:
the lower base plate comprises a first surface comprising at least one diamond channel, and the upper base plate comprises a second surface comprising a metal electrode corresponding to the at least one diamond channel in position;
the liquid metal is disposed in a center of the at least one diamond channel; the first surface is bonded to the second surface through an adhesive;
the liquid metal is movable in the at least one diamond channel and is in electrical contact with the metal electrode of the upper base plate during movement.
2. The acceleration sensor of claim 1, wherein the lower base plate comprises two diamond channels arranged in a cross pattern, and the upper base plate comprises four metal electrodes distributed along a cross line of the cross pattern.
3. The acceleration sensor of claim 1, wherein the lower base plate is an acrylic plate, the upper base plate is borosilicate glass, and the metal electrode is a symmetrical zigzag nickel chromium conductive layer.
4. The acceleration sensor of claim 2, wherein the lower base plate is an acrylic plate, the upper base plate is borosilicate glass, and the metal electrode is a symmetrical zigzag nickel chromium conductive layer.
5. A method for manufacturing the acceleration sensor of claim 1, the method comprising:
1) preparing the upper base plate and the lower upper base plate;
2) forming diamond channels on the lower base plate through deep reactive ion etching, modifying a surface of the diamond channels using a sandblasting system to form a serrated micro convex structure on side walls of the diamond channels; depositing a chromium layer as an adhesive layer on a glass base plate using an electron beam evaporator, depositing a nickel layer on the chromium layer; with a photoresist as an etching mask, etching the nickel layer and the chromium layer using a wet etchant to obtain a nickel chromium alloy electrode;
3) placing the liquid metal 5 encapsulated in graphene in the center of the diamond channels, and bonding the upper base plate and the lower base plate using a curable adhesive, to produce the acceleration sensor; and
4) testing the acceleration sensor, and calibrating an acceleration value of the acceleration sensor.
6. The method of claim 5, wherein 4) is performed as follows:
4.1) measuring an initial resistance of each metal electrode of the acceleration sensor using a DC resistance meter; placing the acceleration sensor in a fixed position of a centrifugal testing device;
4.2) controlling a rotational speed of a rotating plate of the centrifugal testing device, applying an acceleration from 0 to 2 g to the acceleration sensor, and synchronously recording resistance changes of the four metal electrodes, and monitoring a movement position of the liquid metal encapsulated in graphene in the diamond channel under a high-speed camera;
4.3) performing centrifugal experiments in two directions in sequence, applying different accelerations, and recording the resistance changes of the corresponding electrodes; and
4.4) based on collected experimental data, establishing a relationship between acceleration and the resistance changes of the metal electrodes, and calibrating a magnitude of acceleration using the resistance changes of the metal electrodes....

Claims

What is claimed is:
1. An insecticidal gun, comprising:
a gun body;
a feeding member;
a percussion member;
a trigger; and
an electric drive mechanism;
wherein:
the gun body comprises a launching chamber; the feeding member is slidably connected to the gun body and comprises a material storage chamber configured to communicate with the launching chamber;
the electric drive mechanism is configured to drive the percussion member to move in the launching chamber;
when the percussion member is driven by the electric drive mechanism to move, the feeding member moves along an axial direction of the gun body, so that the material storage chamber communicates with the launching chamber intermittently; and
the trigger is rotatable with respect to the gun body to activate or inactivate the electric drive mechanism.
2. The gun of claim 1, wherein the percussion member comprises a rack extending along the axial direction of the gun body; the electric drive mechanism comprises a motor disposed on the gun body and a gear set driven by the motor; and the gear set comprises a driving gear meshed with the rack.
3. The gun of claim 2, wherein the driving gear comprises a cam; the feeding member comprises a connecting rod extending to one side of the cam; when in use, the electric drive mechanism drives the percussion member to move, the cam leans against the connection rod to drive the feeding member on the gun body, and the material storage chamber communicates with the launching chamber; and
the insecticidal gun further comprises an elastic member disposed on one side of the feeding member and sleeving the gun body; when the cam is separated from the connection rod, the elastic member drives the feeding member to move, and the material storage chamber is disconnected with the launching chamber.
4. The gun of claim 3, wherein the feeding member comprises a storage member sleeving the gun body; the storage member comprises an accommodation space and the elastic member is disposed in the accommodation space.
5. The gun of claim 4, wherein a cross-section of the material storage chamber gradually increases in a direction away from the gun body.
6. The gun of claim 3, wherein the gun body further a guide groove, and the connecting rod is slidable in the guide groove.
7. The gun of claim 2, wherein the driving gear comprises a stop part; the trigger comprises a switching member disposed on one side of the stop part; the switching member is movable along the axial direction of the gun body to change between a single firing position and a continuous firing position; the trigger further comprises a firing seat configured to pushing against or detach from the switch; when the switching member is in a single firing position, the stop part abuts against the switching member and the firing seat detaches from the switch; the switching member comprises an active part abutting against the stop part; when moving to a continuous firing position, the switching member pushes the active part to move and release the stop part.
8. The gun of claim 1, wherein the gun body comprises a switch electrically connected to the electric drive mechanism on one side of the trigger; when rotating relative to the gun body, the trigger presses or releases the switch to open or close the electric drive mechanism.
9. The gun of claim 1, wherein the percussion member comprises one end extending into the launching chamber, and a seal ring is disposed on an outer wall of the end....

Claims

What is claimed is:
1. A method for promoting expression of a foreign gene in a plant, the method comprising: constructing a recombinant vector comprising a foreign gene operably linked to a soybean gene promoter pRPS28 or an intron-comprising soybean gene promoter pRPS28-I, and introducing the recombinant vector into the plant; the promoter pRPS28 being represented by SEQ ID NO: 2, and the intron-comprising promoter pRPS28-I being represented by SEQ ID NO: 3.
2. The method of claim 1, wherein the foreign gene is a beta-glucuronidase (GUS) gene.
3. The method of claim 1, wherein the plant is soybean, and the expression of the foreign gene occurs in cotyledons, radicles, plumules, true leaves, compound leaves, buds, petioles, internodes, roots and root nodules of the soybean.
4. The method of claim 1, wherein the plant is Arabidopsis, and the expression of the foreign gene occurs in whole plant, flower and pod of the Arabidopsis.
5. The method of claim 1, wherein the plant is tobacco, and the expression of the foreign gene occurs in leaves of the tobacco.
6. A method for preparing a recombinant vector comprising a soybean gene promoter, the method comprising inserting a soybean gene promoter pRPS28 or pRPS28-I into a vector pCAMBIA1391Z-BAR, wherein inserting the soybean gene promoter pRPS28 or pRPS28-I into the vector pCAMBIA1391Z-BAR comprises using a PCR amplification fragment of pRPS28 or pRPS28-I as a template, and cloning the PCR amplification fragment into a soybean stable transformation vector pCAMBIA1391Z-BAR by a seamless cloning method to obtain a soybean stable transformation vector pRPS28-GUS-BAR or pRPS28-I-GUS-BAR; wherein:
the vector pCAMBIA1391Z-BAR is obtained by linearizing a vector pCAMBIA1391Z with a restriction enzyme XhoI, and replacing a gene HygR with a gene BAR by the seamless cloning method;
the recombinant vector pRPS28-GUS-BAR is amplified using the following primers:
pRPS28-GUS-BAR-F:
(SEQ ID NO: 14)
GACCATGATTACGCCAAGCTTCACCACCCAATCCATAACCACCAC;
pRPS28-GUS-BAR-R:
(SEQ ID NO: 13)
CCAGTGAATTCCCGGGGATCCCTGATGCAAAACACGAACAAAGAAAG;
the recombinant vector pRPS28-I-GUS-BAR is amplified using the following primers:
pRPS28-I-GUS-BAR-F:
(SEQ ID NO: 14)
GACCATGATTACGCCAAGCTTCACCACCCAATCCATAACCACCAC;
pRPS28-I-GUS-BAR-R:
(SEQ ID NO: 15)
CCAGTGAATTCCCGGGGATCC CCTGCTCAAACACAATCAACAG; and
the promoter pRPS28 has the nucleotide sequence of SEQ ID NO: 2, and the promoter pRPS28-I has the nucleotide sequence of SEQ ID NO: 3....

Claims

What is claimed is:
1. An electronic control actuator, comprising:
a lower housing and an upper housing, the lower housing or the upper housing comprising a plurality of first matching holes, and the lower housing and the upper housing cooperating to form an installation space;
an isolation plate disposed between the lower housing and the upper housing, the isolation plate comprising a plurality of second matching holes, and a plurality of locating pins respectively passing through the plurality of first matching holes and the plurality of second matching holes; and
a compact gear assembly and a drive motor both disposed in the installation space, and the compact gear assembly being cooperatively connected to the drive motor;
wherein:
the compact gear assembly comprises:
a first reduction gear, in transmission connection to a motor shaft of the drive motor at a first location;
a second reduction gear, fixedly coaxially connected to the first reduction gear; and
a sector gear, the sector gear being meshed with the second reduction gear at a second location; the sector gear being coaxially rotationally connected to an output shaft; and the sector gear comprising a matching groove;
the motor shaft extends through the matching groove in the sector gear; the second reduction gear is disposed between the drive motor and the first reduction gear; whereby both the second reduction gear and the sector gear are disposed between the drive motor and the first reduction gear; and the second location is disposed adjacent to the drive motor with respect to the first location along an axial direction of the motor shaft;
the lower housing comprises a limiting part disposed on one side of the locating pins away from the first matching holes; the limiting part comprises a support surface, and when the lower housing is cooperatively connected to the upper housing, the support surface abuts against one side of the isolation plate away from the first matching holes; and
the lower housing comprises a side wall, a motor-mounting part, an air-cooled element, and a water-cooled element; the motor-mounting part is disposed in a middle of the side wall; the air-cooled element is disposed around the motor-mounting part; the water-cooled element is disposed in the side wall and corresponds to the air-cooled part; and the water-cooled element is disposed around the motor-mounting part.
2. The electronic control actuator of claim 1, wherein the first matching holes are two in number, and are disposed along a diagonal of the lower housing or the upper housing.
3. The electronic control actuator of claim 1, wherein the matching groove is an arc-shaped structure, and a distance between a motion trajectory of the motor shaft within the arc-shaped structure and a root circle of the sector gear is constant.
4. The electronic control actuator of claim 3, further comprising:
the output shaft, disposed on the upper housing and coaxially rotationally connected to the sector gear;
a locating part sleeving the output shaft; and
an elastic member sleeving the output shaft, the elastic member comprising a first end and a second end opposite to the first end, and the first end being connected to the locating part, and the second end being cooperatively connected to the upper housing.
5. The electronic control actuator of claim 4, wherein one side of the locating part facing the elastic member comprises a first groove, and the first end is cooperatively limited in the first groove; the upper housing comprises a second groove, and the second end is cooperatively limited in the second groove; and the locating part is rotatable along with the rotation of the output shaft.
6. An exhaust gas treatment system, comprising the electronic control actuator of claim 1.
7. The system of claim 6, further comprising an exhaust gas circulation pipeline and a valve disposed on the exhaust gas circulation pipeline, wherein the electronic control actuator is configured to control the opening or closing of the valve.
8. A vehicle, comprising the exhaust gas treatment system of claim 6....

Claims

What is claimed is:
1. A supporting device for a punching bag, comprising:
1) a hollow tubular pillar;
2) a connector;
3) a flange body;
4) a rubber shock absorber; and
5) a support tray;
wherein:
the connector is tubular, and comprises a first end and a second end; the second end is bigger than the first end in diameter; the first end is disposed into the hollow tubular pillar; the connector comprises a first connection hole, and the hollow tubular pillar comprises a second connection hole; the connector and the hollow tubular pillar are fixed by a locking screw through the first connection hole and the second connection hole;
the flange body comprises a central blind hole, and the second end of the connector is disposed into the central blind hole;
the flange body further comprises a radial base; a circumference of the radial base comprises a plurality of mounting holes configured to receive a counterweight unit to stabilize the supporting device;
the support tray is a disc structure, comprising at least two support rods; one end of each support rod is fixed to the hollow tubular pillar, and the other end is fixed to the support tray; and the support tray is configured to support a punching bag body; and
the rubber shock absorber comprises a central hole; the hollow tubular pillar is disposed through the central hole; and the rubber shock absorber is disposed below and leans against the support tray.
2. The device of claim 1, wherein a periphery of the support tray is bent upwards by 90 degrees to form a smooth contact surface.
3. The device of claim 1, wherein the first end of the connector is a shrinking end towards the hollow tubular pillar thus facilitating a connection between the connector and the hollow tubular pillar.
4. The device of claim 1, wherein a step is disposed in the central blind hole of the flange body to divide the central blind hole into a first part and a second part, and a size of the first part is larger than that of the second part; the locking screw is located in the first part and supported by the step, and the second end of the connector is firmly fixed in the second part....

Claims

What is claimed is:
1. A power amplifier, comprising:
1) a preamplifier circuit, the preamplifier circuit comprising a first DC blocking capacitor C1, a first decoupling capacitor C2, a second decoupling capacitor C3, a stabilizing resistor Rill, a first AC blocking resistor RG1, a first input inductor L1, a second input inductor L2, an output inductor L3, a first input microstrip line MLIN1, a second input microstrip line MLIN2, an output microstrip line MLIN3, and a first transistor Q1; and
2) a post amplifier circuit, the post amplifier circuit comprising a first gate microstrip line MLIN4, a second gate microstrip line MLIN5, a third gate microstrip line MLIN6, a fourth gate microstrip line MLIN7, a drain inductor L4, a first drain microstrip line MLIN8, a second drain microstrip line MLIN9, a second AC blocking resistor RG2, a third decoupling capacitor C5, a fourth decoupling capacitor C6, a third DC blocking capacitor C7, an AC blocking inductor L5, a second transistor Q2, a third transistor Q3, and a fourth transistor Q4;
wherein:
a first end of the first DC blocking capacitor C1 acts as an input terminal of the preamplifier circuit, and a second end of the first DC blocking capacitor C1 is connected to the stabilizing resistor Rin, the first input inductor L1, the first input microstrip line MLIN1, and a gate electrode of the first transistor Q1 sequentially;
a first end of the first decoupling capacitor C2 is grounded, and a second end of the first decoupling capacitor C2 is connected to the first AC blocking resistor RG1, the second input inductor L2, the second input microstrip line MLIN2, and the gate electrode of the first transistor Q1 sequentially;
a junction of the first decoupling capacitor C2 and the first AC blocking resistor RG1 is connected to a gate supply voltage Vgs1;
a first end of the second decoupling capacitor C3 is grounded, and a second end of the second decoupling capacitor C3 is connected to the output inductor L3, the output microstrip line MLIN3, and a drain electrode of the first transistor Q1; a junction of the second decoupling capacitor C3 and the output inductor L3 is connected to a drain supply voltage Vds1; and a junction of the output inductor L3 and the output microstrip line MLIN3 acts as an output terminal of the preamplifier circuit;
a second DC blocking capacitor C4 is disposed between the preamplifier circuit and the post amplifier circuit;
a first end of the first gate microstrip line MLIN4 acts as an input terminal of the post amplifier circuit, and a second end of the first gate microstrip line MLIN4 is connected to the second gate microstrip line MLIN5, the third gate microstrip line MLIN6, the fourth gate microstrip line MLIN7, the second AC blocking resistor RG2, and the third decoupling capacitor C5 sequentially; and one end of the third decoupling capacitor C5 is grounded;
a junction of the second AC blocking resistor RG2 and the third decoupling capacitor C5 is connected to a gate supply voltage Vgs2; a junction of first gate microstrip line MLIN4 and the second gate microstrip line MLIN5 is connected to a gate electrode of the second transistor Q2; a junction of the second gate microstrip line MLIN5 and the third gate microstrip line MLIN6 is connected to a gate electrode of the third transistor Q3; a junction of the third gate microstrip line MLIN6 and the fourth gate microstrip line MLIN7 is connected to a gate electrode of the fourth transistor Q4;
the drain inductor L4 is disposed between drain electrodes of the second transistor Q2 and the third transistor Q3;
the first drain microstrip line MLIN8 is disposed between drain electrodes of the third transistor Q3 and the fourth transistor Q4; and
a junction of the first drain microstrip line MLIN8 and the fourth transistor Q4 is connected to a first end of the second drain microstrip line MLIN9; a second end of the second drain microstrip line MLIN9 is connected to first ends of the fourth decoupling capacitor C6, the AC blocking inductor L5, and the third DC blocking capacitor C7; a second end of the fourth decoupling capacitor C6 is grounded; a second end of the AC blocking inductor L5 is connected to a voltage source Vds2; and a second end of the third DC blocking capacitor C7 acts as an output terminal of the post amplifier circuit....

Claims

What is claimed is:
1. A lidar system, comprising:
a laser;
an optical detector;
a laser antenna; and
a silicon-based integrated magneto-optical circulator comprising an input port, a receiving port, and an emission port;
wherein:
the silicon-based integrated magneto-optical circulator comprises a silicon-based integrated Mach-Zehnder interference structure or a silicon-based integrated micro-ring structure, and a plurality of silicon-based integrated magneto-optical waveguides;
the laser is aligned and coupled to the input port of the silicon-based integrated magneto-optical circulator via an optical fiber, a grating coupler, or an edge coupler;
the optical detector is aligned and coupled to the receiving port of the silicon-based integrated magneto-optical circulator via the optical fiber, the grating coupler, or the edge coupler;
the laser antenna is aligned and coupled to the emission port of the silicon-based integrated magneto-optical circulator via the optical fiber, the grating coupler, or the edge coupler; the laser is configured to generate a laser light transmitting to the laser antenna via the silicon-based integrated magneto-optical circulator; the laser antenna is configured to collimate the laser light, compress the divergence angle of the laser light, and emits the compressed laser light; moreover, the laser antenna is also configured to receive the reflected light of a detected object;
when the lidar system is used, the input port of the silicon-based integrated magneto-optical circulator is configured to receive a detection signal generated by the laser; the detection signal enters the laser antenna through the silicon-based integrated magneto-optical circulator for single-channel emission, and is reflected by the detected object, thereby generating a reflected signal; the reflected signal is received by the laser antenna, returns to the silicon-based integrated magneto-optical circulator through the emission port, and then returns to the optical detector connected to the receiving port of the silicon-based integrated magneto-optical circulator from another channel, to run in a full-duplex mode; and
the silicon-based integrated Mach-Zehnder interference structure comprises two interference arms, and the plurality of silicon-based integrated magneto-optical waveguides comprise 180° curved waveguides to steer a light to an opposite direction;
a reciprocal phase difference between the two interference arms is an odd multiple of π/2; and a non-reciprocal phase difference between the two interference arms is set to be π/2 by configuring the length of each silicon-based integrated magneto-optical waveguide;
one of the two interference arms is adapted to unidirectionally transmit light in a forward direction, and the other one of the two interference arms is adapted to unidirectionally transmit light in a backward direction; and when in use, the light transmitted in the forward direction and the light transmitted in the backward direction are separated from each other.
2. The lidar system of claim 1, wherein:
the silicon-based integrated Mach-Zehnder interference structure further comprises a light splitting part, a light combining part, four ports, and two edges; the light splitting part and the light combining part, respectively, comprises two integrated 3 dB couplers; two of the four ports are disposed at one edge and the remaining two ports are disposed at another edge; the two ports at one edge are respectively used as the input port and the receiving port of the silicon-based integrated magneto-optical circulator; one of the two ports at another edge isolated from the input port is suspended, and the remaining port is used as the emission port of the silicon-based integrated magneto-optical circulator.
3. The lidar system of claim 1, wherein:
the silicon-based integrated micro-ring structure comprises two silicon-based integrated straight waveguides and a silicon-based integrated ring optical waveguide; the two silicon-based integrated straight waveguides are disposed parallel to each other, and the silicon-based integrated ring optical waveguide is disposed between the two silicon-based integrated straight waveguides; the silicon-based integrated ring optical waveguide is circular or racetrack-shaped; the silicon-based integrated magneto-optical waveguides are disposed in the silicon-based integrated ring waveguide; and
the silicon-based integrated micro-ring structure comprises four ports and two edges, in which two ports are disposed at one edge and the remaining two ports are disposed at another edge; the two ports on one edge are respectively used as the input port of the silicon-based integrated magneto-optical circulator and the emission port of the silicon-based integrated magneto-optical circulator; one of the two ports at another edge disposed in the same silicon-based integrated straight waveguide as the emission port of the silicon-based integrated magneto-optical circulator is used as the receiving port; and the remaining port at another edge is suspended.
4. The lidar system of claim 1, wherein the laser antenna is a phased array laser antenna....

Claims

What is claimed is:
1. A pipeline, comprising:
a pipeline body:
a sealing member; and
a sleeve;
wherein:
the pipeline body comprises a connection end; the connection end comprises a first section and a second section adjacent to the first section; and the first section comprises an end face perpendicular to an axis of the pipeline body;
the sealing member comprises a first annular part and a second annular part; the first annular part and the second annular part are disposed coaxially; the second annular part comprises a first surface oriented toward the first annular part; an axial projection of the first annular part falls within the first surface; the first surface comprises a first region and a second region; the first region is enclosed by the axial projection of the first annular part, and the second region surrounds the axial projection of the first annular part; the first annular part sleeves an outer wall of the first section; and the end face of the first section abuts against the first region;
the sleeve sleeves the second section and the first annular part; and the sleeve comprises an end face abutting against the second region; and
an outer diameter of the second annular part increases and then decreases along the axial direction.
2. The pipeline of claim 1, wherein the sleeve is at least partially connected to the first annular part by a sliding fit.
3. The pipeline of claim 2, wherein the first annular part comprises a distal end and a proximal end; the distal end is away from the second annular part, and the proximal end is adjacent to the second annular part; an outer diameter of the first annular part gradually decreases from the proximal end to the distal end;
the sleeve comprises a section sleeving the first annular part; and an inner diameter of the section gradually decreases to match the decrease in the outer diameter of the first annular part.
4. The pipeline of claim 2, wherein the first annular part comprises a distal end and a proximal end; the distal end is away from the second annular part, and the proximal end is adjacent to the second annular part; an outer diameter of the first annular part gradually increases from the proximal end to the distal end;
the sleeve comprises a section sleeving the first annular part; and an inner wall of the section is cylindrical in the shape.
5. The pipeline of claim 1, wherein the first annular part comprises a distal end and a proximal end; the distal end is away from the second annular part, and the proximal end is adjacent to the second annular part;
an outer diameter of the first annular part gradually decreases from the proximal end to the distal end; the sleeve comprises a section sleeving the first annular part;
and an inner diameter of the section gradually decreases to match the decrease in the outer diameter of the first annular part.
6. The pipeline of claim 1, wherein the first annular part comprises a distal end and a proximal end; the distal end is away from the second annular part, and the proximal end is adjacent to the second annular part;
an outer diameter of the first annular part gradually increases from the proximal end to the distal end; the sleeve comprises a section sleeving the first annular part;
and an inner wall of the section is cylindrical in the shape.
7. The pipeline of claim 1, wherein an inner diameter of the second annular part is 1.05-1.65 times that of the pipeline body.
8. The pipeline of claim 1, wherein the second annular part further comprises a second surface and a side surface; the second surface is opposite to the first surface; the side surface connects the first surface and the second surface; and a smooth transition is formed between the second surface and the side surface.
9. The pipeline of claim 1, wherein the sleeve comprises a first sleeve part and a second sleeve part; the first sleeve part sleeves an outer wall of the second section; the second sleeve part sleeves an outer wall of the first annular part; the sleeve further comprises a first tightening section and/or a second tightening section; the first tightening section is disposed on the first sleeve part; and the second tightening section is disposed on the second sleeve part.
10. A liquid chromatography system, comprising:
the pipeline of claim 8;
a target component, comprising a liquid channel entrance comprising internal threads; and
a pipeline connector comprising a screw;
wherein:
the screw comprises a first through hole; the first through hole comprises a first hole part and a second hole part disposed adjacent to the first hole part; the first hole part has a greater diameter than the second hole part; and a junction of the first hole part and the second hole part forms a first step structure; and
the screw sleeves an outer wall of the pipeline; the sleeve comprises a distal end away from the sealing member; the distal end of the sleeve abuts against the first step structure; and the screw is threaded into the internal threads of the liquid channel entrance.
11. A pipeline, comprising:
a pipeline body;
a sealing member; and
a sleeve;
wherein:
the pipeline body comprises a connection end; the connection end comprises a first section and a second section adjacent to the first section; and the first section comprises an end face perpendicular to an axis of the pipeline body;
the sealing member comprises a first annular part and a second annular part; the first annular part and the second annular part are disposed coaxially; the second annular part comprises a first surface oriented toward the first annular part; an axial projection of the first annular part falls within the first surface; the first surface comprises a first region and a second region; the first region is enclosed by the axial projection of the first annular part, and the second region surrounds the axial projection of the first annular part; the first annular part sleeves an outer wall of the first section; and the end face of the first section abuts against the first region;
the sleeve sleeves the second section and the first annular part; and the sleeve comprises an end face abutting against the second region; and
an outer diameter of the second annular part repeats a pattern of increasing and then decreasing along the axial direction multiple times.
12. A pipeline connector, comprising a screw; wherein:
the screw comprises a first through hole; the first through hole comprises a first hole part and a second hole part disposed adjacent to the first hole part; the first hole part has a greater diameter than the second hole part; and a junction of the first hole part and the second hole part forms a first step structure;
a sidewall of the screw further comprises a first slot communicating with the first through hole; the first slot extends axially through the sidewall of the screw; a width of the first slot, measured in a direction perpendicular to an axis of the first through hole, is smaller than a diameter of the first hole part but equal to or larger than a diameter of the second hole part;
the pipeline connector further comprises a cap detachably connected to the screw; the cap comprises a second through hole and a protrusion; and the protrusion extends axially along the second through hole;
the second through hole and the first through hole are coaxially disposed;
and the protrusion is at least partially inserted into the first slot.
13. The pipeline connector of claim 12, wherein an outer wall of the screw comprises a first wall section and a second wall section;
the first wall section has a smaller diameter than the second wall section; and the first wall section comprises external threads.
14. The pipeline connector of claim 13, wherein a plane where the first step structure is located intersects with the external threads on the first wall section.
15. The pipeline connector of claim 12, wherein the first through hole further comprises a third hole part; one end of the second hole part is away from the first hole part; the third hole part is disposed at the end of the second hole part;
the third hole part has a greater radial cross-sectional area than the second hole part; and a junction of the third hole part and the second hole part forms a second step structure;
an outer wall of the cap comprises a first cap section; an outer diameter of the first cap section matches an inner diameter of the third hole part, so that the first cap section is connected to the third hole part by an interlocking fit.
16. The pipeline connector of claim 15, wherein the outer wall of the cap further comprises a second cap section connected to the first cap section; the first cap section comprises a distal end away from the screw; the second cap section is connected to the distal end of the first cap section; and the second cap section has a greater radial cross-sectional area than the second wall section.
17. The pipeline connector of claim 15, wherein a sidewall of the cap comprises a second slot communicating with the second through hole; the second slot extends axially through the sidewall of the cap; the second slot and the protrusion are disposed alternately in a circumferential direction....

Claims

What is claimed is:
1. A method for preparing (S)-nicotine by reduction, the method comprising:
conducting a reduction process on an alkene compound shown in Formula I and/or an iminium cation compound shown in Formula II
thereby producing (S)-nicotine;
wherein
the reduction process is performed using a biocatalytic method;
the biocatalytic method comprises: in a coenzyme cycling system, catalytically reducing the alkene compound shown in Formula I and/or the iminium cation compound shown in Formula II by an imine reductase, thereby producing (S)-nicotine;
the coenzyme cycling system further comprises a coenzyme, glucose, and glucose dehydrogenase;
the imine reductase comprises an amino acid sequence selected from SEQ ID NOs: 2-4, 6, and 12-22;
the reduction process is carried out within a temperature range of 15 to 45° C.; and
the reduction process is carried out within a pH range of 6.0 to 8.0.
2. The method of claim 1, wherein
the coenzyme comprises NADP salt and/or NAD salt.
3. The method of claim 1, wherein the glucose dehydrogenase comprises an amino acid sequence shown in SEQ ID NO: 1.
4. The method of claim 1, wherein the reduction process is conducted in a buffer solution; and the buffer solution comprises phosphate buffer, Tris-HCl buffer, or TEA-HCl buffer.
5. The method of claim 1, wherein the alkene compound as shown in Formula I or the iminium cation compound as shown in Formula II are prepared by desalination and/or cyclization of a compound as shown in Formula III, or a salt thereof;
6. The method of claim 5, wherein a method for synthesizing the salt of the compound of Formula III comprises:
mixing a compound A with N-methylpyrrolidone and an organic base to yield a compound D; and mixing the compound D with an acid to yield the salt of the compound of Formula III; the reaction equations are as follows:
7. The method of claim 5, wherein a method for synthesizing the salt of the compound of Formula III, and the method comprises:
mixing the compound A with N-methylpyrrolidone and an organic base to form a resultant product; neutralizing the resultant product with an acid to reach a pH of 7-8, thereby yielding a compound B; and mixing the compound B with an acid to produce the salt of the compound of Formula III; the reaction equations are as follows:
8. The method of claim 6, wherein a method for synthesizing the compound A comprises:
mixing nicotinic acid with methanol to form a mixture; and esterifying the mixture in a high acidic environment, thereby yielding the compound A.
9. The method of claim 7, wherein a method for synthesizing the compound A comprises:
mixing nicotinic acid with methanol to form a mixture; and esterifying the mixture in a high acidic environment, thereby yielding the compound A.
10. The method of claim 1, comprising: mixing nicotinic acid with methanol to form a mixture; and esterifying the mixture in a high acidic environment, thereby obtaining a compound A; mixing the compound A with N-methylpyrrolidone and the organic base to yield the compound D, or mixing the compound A with N-methylpyrrolidone and the organic base, and further adding a first acid for neutralization, to yield the compound B; mixing the compound B or the compound D with a second acid, thereby producing the salt of the compound of Formula III; desalting and cyclizing the salt of the compound of Formula III, and reducing a resulting product using a biocatalytic method or a chiral metal catalyst to obtain (S)-nicotine; the reaction equations are as follows:...

Claims

What is claimed is:
1. A crystal form A of a compound of formula Ia:
wherein a CuKα X-ray powder diffraction (XRPD) spectrum of the crystal form A has diffraction peaks at diffraction angle 2θ positions of 6.13°±0.2°, 7.77°±0.2°, 9.43°±0.2°, 10.61°±0.2°, 11.88°±0.2°, 12.44°±0.2°, 12.80°±0.2°, 13.88°±0.2°, 14.28°±0.2°, 14.66°±0.2°, 15.51°±0.2°, 17.09°±0.2°, 17.55°±0.2°, 17.88°±0.2°, 18.95°±0.2°, 21.18°±0.2°, 21.86°±0.2°, 22.40°±0.2°, 22.87°±0.2°, 23.52°±0.2°, 24.93°±0.2°, 25.69°±0.2°, 26.63°±0.2°, 28.60°±0.2° and 30.46°±0.2°.
2. A method for prevention or treatment of AIDS, the method comprising administering to a patient in need thereof a pharmaceutical composition comprising the crystal form A of the compound of formula Ia of claim 1....

Claims

What is claimed is:
1. A method for pre-positioning a rotor of an outdoor fan in a high-speed counter-rotation state before operation, the outdoor fan comprising a permanent-magnet synchronous motor and a wind wheel; the permanent-magnet synchronous motor comprising a motor body and a motor controller; the motor body comprising a stator assembly and a permanent-magnet rotor assembly; the motor controller comprising a microprocessor and an inverter circuit; the inverter circuit comprising a plurality of bridge arms, and each bridge arm comprising an upper bridge arm and a lower bridge arm; each upper bridge arm comprising an upper electronic switching tube, and each lower bridge arm comprising a lower electronic switching tube, the method comprising:
1) during a high-speed counter-operation state, sending, by the microprocessor, a signal to the inverter circuit to turn off all upper electronic switching tubes and turn on all lower electronic switching tubes, thereby achieving a short-circuit brake to reduce a counter-rotation speed of the wind wheel;
2) measuring a phase current of each phase coil winding in the stator assembly;
3) calculating a back electromotive force of each phase coil winding in the stator based on the phase current of each phase coil winding;
4) calculating a position angle θ0 of the rotor assembly based on the back electromotive force of each phase coil winding;
5) checking if the phase current of each phase coil winding is all smaller than a preset threshold current I0; if not, return to 1); if yes, proceed to 6); and
6) calculating a resistance torque to stop the rotor assembly based on the position angle θ0 of the rotor assembly, and then stopping the rotor assembly to achieve pre-positioning before starting.
2. The method of claim 1, wherein the permanent-magnet synchronous motor is a three-phase permanent-magnet synchronous motor, and phase currents flowing through three-phase coil windings are respectively ia, ib, and ic.
3. The method of claim 2, wherein in 2), the phase currents ia, ib, and ic are detected through current sensors or sampling resistors.
4. The method of claim 3, wherein in 3), a reverse electromotive force of each phase coil winding is calculated as follows:
{
e
a
=
(
j
⁢
ω
⁢
L
s
+
R
s
)
⁢
i
a
e
b
=
(
j
⁢
ω
⁢
L
s
+
R
s
)
⁢
i
b
e
c
=
(
j
⁢
ω
⁢
L
s
+
R
s
)
⁢
i
c
;
ea, eb, and ec represent reverse electromotive forces of the three-phase coil windings, respectively; Ls is an inductance of the three-phase coil winding of the stator; Rs is a resistance of the three-phase coil winding of the stator; ω is an electrical angular frequency of the permanent-magnet synchronous motor; and j is a coefficient.
5. The method of claim 4, wherein in 4), the position angle of the rotor assembly is calculated as follows:
performing clark transformation on the reverse electromotive forces ea, eb, and ec to obtain eα and eβ:
{
e
α
=
1
3
⁢
(
2
⁢
e
a
-
e
b
-
e
c
)
e
β
=
3
3
⁢
(
e
b
-
e
c
)
;
calculating an arctangent of eα and eβ to obtain the position angle of the rotor:
θ
0
=
arc
⁢
tan
⁢
(
e
α
e
β
)
.
6. The method of claim 5, wherein in 6), the resistance torque to stop the rotor assembly is calculated by:
Te=is×sin(θis−ω0*t−θe)×1.5×np×φf;
where, is is a current vector on a dq-axis; θis is an angle of the current vector; np is a number of poles of the permanent-magnet synchronous motor; φf is a magnetic flux of the permanent magnet; ω0 is an angular velocity at which the permanent-magnet synchronous motor operates at low speeds; and t is time.
7. The method of claim 6, wherein when θis is equal to θ0, a continuous negative torque is generated during a next half electrical cycle, to stop the rotor in low-speed rotation.
8. The method of claim 7, wherein following 6), the method further comprises 7): running a normal start-up program for the permanent-magnet synchronous motor.
9. The method of claim 8, wherein the normal start-up program comprises providing an initial current for an open-loop control to initiate the rotation of the permanent-magnet synchronous motor, and then switching to a closed-loop control once the permanent-magnet synchronous motor runs at a speed V0.
10. The method of claim 8, wherein the speed V0 is in the range of 300 rpm to 400 rpm....

Claims

What is claimed is:
1. A lumbar support belt, comprising:
a back belt;
a first waist belt;
a second waist belt;
a tightening mechanism;
a first drawstring; and
a second drawstring;
wherein:
the first waist belt and the second waist belt are connected to two ends of the back belt, respectively, and configured to be wrapped around a waist and an abdomen of a user;
the first waist belt and the second waist belt are adjustable in length;
the back belt is a support board being plastic; the support board comprises a first horizontal groove, a second horizontal groove, and a central transversal axis; the first horizontal groove and second horizontal groove extend along a horizontal plane; the central transversal axis extends along a central transversal plane; the central transversal axis and the central transversal plane are substantially perpendicular to the horizontal plane; the first horizontal groove and the second horizontal groove are disposed substantially symmetrically about the central transversal plane;
the first waist belt comprises a first front part and the second waist belt comprises a second front part; the first front part and the second front part are attached to each other to form a compression belt configured for abutting against the abdomen of the user;
the first waist belt comprises a first back part and the second waist belt comprises a second back part; the first back part and the second back part are disposed at a distance from the support board; the first back part and the second back part are connected to the support board through the tightening mechanism; and
the lumbar support belt is configured to be wrapped around the waist, the tightening mechanism is configured to be tightened or loosened to control the support board and the compression belt to press the waist and abdomen;
the tightening mechanism comprises a first connecting plate and a second connecting plate which are of a same shape and have a same curvature as the support board;
the first connecting plate comprises a first fixed end and a first free end;
the first fixed end is connected to one end of the first waist belt; the first connecting plate comprises an inner surface comprising a first sliding block; the first sliding block is disposed into the first horizontal groove and is configured to slide back and forth to drive the first connecting plate to move horizontally with respect to the support board; the first connecting plate further comprises a first group of pulleys;
the second connecting plate comprises a second fixed end and a second free end; the second fixed end is connected to one end of the second waist belt; the second connecting plate comprises an inner surface comprising a second sliding block; the second sliding block is disposed into the second horizontal groove and is configured to slide back and forth to drive the second connecting plate to move horizontally with respect to the support board; the second connecting plate further comprises a second group of pulleys;
the first drawstring and the second drawstring are wrapped around the first group of pulleys and the second group of pulleys; whereby when the first drawstring or the second drawstring is pulled tight, the first connecting plate and the second connecting plate move towards each other;
the first group of pulleys comprises a first upper group of pulleys and a first lower group of pulleys; the first upper group of pulleys and the first lower group of pulleys are disposed on an upper part and a lower part of the first connecting plate, respectively;
the second group of pulleys comprises a second upper group of pulleys and a second lower group of pulleys; the second upper group of pulleys and the second lower group of pulleys are disposed on an upper part and a lower part of the second connecting plate, respectively;
the first drawstring is wrapped around the first upper group of pulleys and the second upper group of pulleys to pull tight or loosen the upper part of the first connecting plate and the upper part of the second connecting plate; whereby the distance between the upper part of the first connecting plate and the upper part of the second connecting plate is adjusted by the first drawstring; and
the second drawstring is wrapped around the first lower group of pulleys and the second lower group of pulleys to pull tight or loosen the lower part of the first connecting plate and the lower part of the second connecting plate; whereby the distance between the lower part of the first connecting plate and the lower part of the second connecting plate is adjusted by the second drawstring.
2. The belt of claim 1, wherein each of the first upper group of pulleys, the first lower group of pulleys, the second upper group of pulleys, and the second lower group of pulleys comprise a first pulley and a second pulley having a smaller diameter than the first pulley; the first pulley and the second pulley are coaxial; an axial line of the first pulley and the second pulley is perpendicular to the direction of motion of the first connecting plate or the second connecting plate; each connecting plate comprises an outer surface and an inner surface; the outer surface protrudes to form a cavity and the cavity extends through the inner surface; a sidewall connecting the inner surface and the outer surface comprises a plurality of notches; the first drawstring or the second drawstring comprises a first end and a second end; and the second end of the first drawstring or the second drawstring passes through at least one of the plurality of notches on the first connecting plate and the second connecting plate so that the first drawstring or the second drawstring is wrapped around the first group of pulleys and the second group of pulleys.
3. The belt of claim 2, wherein the lumbar support belt further comprises a height-adjustable board disposed on the support board; the support board further comprises a plurality of locating holes spaced apart from each other; the height-adjustable board comprises at least one locating block; the at least one locating block is inserted into the plurality of locating holes to adjust a height of the height-adjustable board relative to the support board.
4. The belt of claim 3, wherein the lumbar support belt further comprises a box for receiving; the first drawstring or the second drawstring; the first end of the first drawstring or the second drawstring is secured to the box; the box comprises a bottom surface provided with a hook of a hook-loop fastener; each of the first waist belt and the second waist belt comprises an outer surface provided with a loop of the hook-loop fastener; and the hook of the box is attached to the loop of one of the first waist belt and the second waist belt.
5. The belt of claim 4, wherein the lumbar support belt further comprises a wire hinge disposed on each end of the compression belt to control the tightening mechanism.
6. The belt of claim 5, wherein the support board, the abdominal compression board, and the height-adjustable board each comprise a plurality of vent holes.
7. The belt of claim 6, wherein the support board further comprises an inner surface comprising an airbag cushion.
8. The belt of claim 1, wherein an abdominal compression board is attached to the compression belt.
9. The belt of claim 8, wherein each of the first waist belt and the second waist belt comprises a first part and a second part sewn onto the first part; the first part comprises a first stretch fabric; the second part comprises a second stretch fabric; an elastic deformation of the first stretch fabric is larger than that of the second stretch fabric; and the compression belt employs the second stretch fabric.
10. The belt of claim 9, wherein the lumbar support belt further comprises a belt cutting template used in combination with a pair of scissors to cut an overlong part of the first waist belt and the second waist belt....

Claims

What is claimed is:
1. A foldable file box, comprising:
a plastic sheet, the plastic sheet comprising a bottom wall and two side walls, and the two side walls being foldable relative to the bottom wall to form a U-shaped structure;
two side frames, interlocking with the bottom wall and the two side walls to form a box structure comprising a top opening;
two hanging rods, each hanging rod comprising a bottom portion interlocking with a top part of the plastic sheet and two ends respectively interlocking with the two side frames; and
a top cover, interlocking with the two side frames and the two hanging rods to close the top opening.
2. The foldable file box of claim 1, wherein the two side walls and the bottom wall each comprise a plurality of clasps that are foldable; and the two side frames and the two hanging rods each comprise a plurality of first grooves for respectively interlocking with corresponding clasps.
3. The foldable file box of claim 2, wherein each of the two side frames comprises an inner wall comprising a U-shaped groove; and the two side walls and the bottom wall are embedded into the U-shaped groove.
4. The foldable file box of claim 3, wherein the plurality of clasps are trapezoidal structures disposed on a top portion of each of the two side walls and both ends of the bottom wall; the trapezoidal structures on the two side walls are foldable and interlock with the two hanging rods; and the trapezoidal structures on the bottom wall are foldable and interlock with the two side frames.
5. The foldable file box of claim 4, wherein the trapezoidal structures are bent to an angle of approximately 45° relative to the two side walls or the bottom wall.
6. The foldable file box of claim 2, wherein the plurality of clasps are trapezoidal structures disposed on a top portion of each of the two side walls and both ends of the bottom wall; the trapezoidal structures on the two side walls are foldable and interlock with the two hanging rods; and the trapezoidal structures on the bottom wall are foldable and interlock with the two side frames.
7. The foldable file box of claim 6, wherein the trapezoidal structures are bent to an angle of approximately 45° relative to the two side walls or the bottom wall.
8. The foldable file box of claim 1, wherein both ends of each of the two hanging rods comprise a U-shaped fastener comprising two outward extending walls; and each of the two side frames comprises a second groove matched with the U-shaped fastener.
9. The foldable file box of claim 1, wherein the plastic sheet, the two side frames, the two hanging rods, and the top cover comprise a flexible material.
10. The foldable file box of claim 1, wherein the two hanging rods and the two side frames each comprise a protruding edge through which a folder is hooked on the box structure.
11. The foldable file box of claim 1, wherein each of the two side frames comprises a bottom part and a plurality of wheels pivotally connected to the bottom part.
12. The foldable file box of claim 11, wherein each of the two side frames comprises a plurality of holes; each of the plurality of wheels comprises a bracket that is rotatable; one end of the bracket is disposed into a corresponding hole of each of the two side frames, and the plurality of wheels are detachably connected to the two side frames....

Claims

What is claimed is:
1. A method for manufacturing a solar cell, comprising:
step S1: perforating a film layer in a first region and/or a second region of a solar cell comprising a substrate where an electrode is to be disposed, thus forming a plurality of holes or grooves;
step S2: growing a seed layer on the solar cell, wherein the seed layer comes into conductive contact with the first region and/or the second region through the plurality of holes or grooves in step S1; and
step S3: horizontally transporting a to-be-electroplated solar cell, wherein a cathode electroplating brush is in contact with the seed layer on the horizontally transported solar cell, to form a cathode of an electroplating system on the seed layer, an anode terminal is disposed in an electroplating liquid in an electroplating bath, and a moving mechanism disposed in the electroplating bath drives the solar cell to move from an inlet to an outlet of the moving mechanism of the solar cell, thus achieving electroplating of the solar cell during energization and the horizontal transportation to form an electroplated electrode region comprising electroplated electrodes;
wherein:
the seed layer comprises a main component and an additional component; the main component is Al having a mass content greater than or equal to 70 wt. % of the seed layer, and the additional component comprises any one or more of Mo, Ti, W, Pd, Bi, Nb, Ta, and Pa; and the additional component has a mass content less than or equal to 30 wt. % of the seed layer; and
a conductive layer is disposed on the seed layer, and the conductive layer comprises Cu.
2. The method for manufacturing the solar cell of claim 1, wherein the first region or/and the second region is/are covered with a tunnel oxide layer and a polysilicon layer.
3. The method for manufacturing the solar cell of claim 1, wherein the seed layer is grown on the solar cell by means of physical vapor deposition.
4. The method for manufacturing the solar cell of claim 3, wherein in step S2, a transparent conductive oxide (TCO) thin film is grown by using a physical vapor deposition method before the seed layer is grown.
5. The method for manufacturing the solar cell of claim 1, wherein when the first region and the second region on the solar cell both exist on a back side of a silicon wafer, the method further comprises:
step S4: after step S3, manufacturing a mask in an electroplated electrode region on the solar cell, etching the solar cell, and forming insulation between electroplated electrodes in the first region and the second region.
6. The method for manufacturing the solar cell of claim 4, wherein when the first region and the second region on the solar cell both exist on a back side of a silicon wafer, between step S2 and step S3, the method further comprises: forming a mask on the seed layer.
7. The method for manufacturing the solar cell of claim 6, wherein after step S3, the method further comprises: removing the mask layer on the seed layer, and then performing wet chemical etching to remove the seed layer.
8. The method for manufacturing the solar cell of claim 7, wherein the TCO thin film is removed during performing wet chemical etching to remove the seed layer.
9. The method for manufacturing the solar cell of claim 1, wherein when the first region and the second region on the solar cell both exist on a back side of a silicon wafer, after step S2, the method further comprises:
step B1: forming a mask on the seed layer, and then performing wet chemical etching to realize insulation between a first portion of the seed layer in the first region and a second portion of the seed layer in the second region; and
step B2: removing the mask on the seed layer.
10. The method for manufacturing the solar cell of claim 1, wherein the solar cell where an electrode is to be disposed is manufactured by using the following steps:
step L1: texturing a surface of a silicon wafer;
step L2: depositing a tunnel oxide layer on a back side of the silicon wafer, and then depositing first doped polysilicon having a first polarity on the tunnel oxide layer;
step L3: depositing a first mask on the first doped polysilicon;
step L4: retaining the first mask predisposed in the first region on the back side of the silicon wafer, and removing the first mask predisposed in the second region on the back side of the silicon wafer;
step L5: removing the first doped polysilicon and the tunnel oxide layer deposited in the second region, and then manufacturing a second mask in the second region;
step L6: depositing the tunnel oxide layer in the second region, and then depositing second doped polysilicon having a second polarity on the tunnel oxide layer in the second region;
step L7: manufacturing a third mask on the second doped polysilicon deposited in the second region;
step L8: retaining the third mask in a non-gap region in the second region, and removing the third mask outside a gap region in the second region;
step L9: removing, by using a wet chemical method, the tunnel oxide layer and the second doped polysilicon deposited in the gap region on the back side of the silicon wafer; and
step L10: performing a double-sided coating on the silicon wafer to obtain the solar cell where the electrode is to be disposed.
11. The method for manufacturing the solar cell of claim 1, wherein the seed layer is formed on the substrate by using physical vapor deposition manufacturing method, or screen printing manufacturing method, or chemical vapor deposition manufacturing method, or electroplating manufacturing method, or chemical plating manufacturing method, or ion plating manufacturing method.
12. The method for manufacturing the solar cell of claim 1, wherein a passivation film is formed between the seed layer and a semiconductor region where an electrode is disposed; and an opening is provided on the passivation film, and the seed layer comes into contact with the semiconductor region through the opening.
13. The method for manufacturing the solar cell of claim 12, wherein a transparent conductive oxide (TCO) thin film is further disposed between the seed layer and the passivation film, and the TCO thin film comes into contact with the semiconductor region through the opening provided on the passivation film.
14. The method for manufacturing the solar cell of claim 13, wherein the TCO thin film is an indium tin oxide or a zinc oxide-based thin film.
15. The method for manufacturing the solar cell of claim 12, wherein the semiconductor region comprises a tunnel oxide layer and doped polysilicon.
16. The method for manufacturing the solar cell of claim 1, wherein a method for growing the conductive layer on the seed layer comprises any of electroplating, physical vapor deposition, screen printing, and chemical plating.
17. The method for manufacturing the solar cell of claim 1, wherein an upper portion of the conductive layer is covered with a protective layer.
18. The method for manufacturing the solar cell of claim 17, wherein the protective layer is an Sn layer or an Ag layer, and the protective layer is grown on the conductive layer by electroplating or chemical plating.
19. The method for manufacturing the solar cell of claim 1, wherein the seed layer is formed by stacking a plurality of sub-seed layers, and contents of the main component in the sub-seed layers stacked decrease along a direction facing away from the substrate.
20. A method for manufacturing a solar cell, comprising:
step S1: perforating a film layer in a first region and/or a second region of a solar cell comprising a substrate where an electrode is to be disposed, thus forming a plurality of holes or grooves;
step S2: growing a seed layer on the solar cell, wherein the seed layer comes into conductive contact with the first region and/or the second region through the plurality of holes or grooves in step S1; and
step S3: horizontally transporting a to-be-electroplated solar cell, wherein a cathode electroplating brush is in contact with the seed layer on the horizontally transported solar cell, to form a cathode of an electroplating system on the seed layer, an anode terminal is disposed in an electroplating liquid in an electroplating bath, and a moving mechanism disposed in the electroplating bath drives the solar cell to move from an inlet to an outlet of the moving mechanism of the solar cell, thus achieving electroplating of the solar cell during energization and the horizontal transportation to form an electroplated electrode region comprising electroplated electrodes;
wherein:
a conductive layer is disposed on the seed layer, and the conductive layer consists of Cu; and
the seed layer comprises a main component and an additional component; the main component is Al having a mass content greater than or equal to 70 wt. % of the seed layer, and the additional component comprises any one or more of Mo, Ti, Pd, Bi, Nb, Ta, and Pa; and the additional component has a mass content less than or equal to 30 wt. % of the seed layer, thereby providing adhesion of the seed layer to the conductive layer.
21. A method for manufacturing a solar cell, comprising:
step S1: perforating a film layer in a first region and/or a second region of a solar cell comprising a substrate where an electrode is to be disposed, thus forming a plurality of holes or grooves;
step S2: growing a seed layer on the solar cell, wherein the seed layer comes into conductive contact with the first region and/or the second region through the plurality of holes or grooves in step S1; and
step S3: horizontally transporting a to-be-electroplated solar cell, wherein a cathode electroplating brush is in contact with the seed layer on the horizontally transported solar cell, to form a cathode of an electroplating system on the seed layer, an anode terminal is disposed in an electroplating liquid in an electroplating bath, and a moving mechanism disposed in the electroplating bath drives the solar cell to move from an inlet to an outlet of the moving mechanism of the solar cell, thus achieving electroplating of the solar cell during energization and the horizontal transportation to form an electroplated electrode region comprising electroplated electrodes;
wherein:
the seed layer comprises a main component and an additional component; the main component is Al having a mass content greater than or equal to 70 wt. % of the seed layer, and the additional component comprises any one or more of W, Cr, Mn, Pd, Bi, Nb, Ta, and Pa; and the additional component has a mass content less than or equal to 30 wt. % of the seed layer; and
a conductive layer is disposed on the seed layer, and the conductive layer comprises Cu.
22. A method for manufacturing a solar cell, comprising:
step S1: perforating a film layer in a first region and/or a second region of a solar cell comprising a substrate where an electrode is to be disposed, thus forming a plurality of holes or grooves;
step S2: growing a seed layer on the solar cell, wherein the seed layer comes into conductive contact with the first region and/or the second region through the plurality of holes or grooves in step S1; and
step S3: horizontally transporting a to-be-electroplated solar cell, wherein a cathode electroplating brush is in contact with the seed layer on the horizontally transported solar cell, to form a cathode of an electroplating system on the seed layer, an anode terminal is disposed in an electroplating liquid in an electroplating bath, and a moving mechanism disposed in the electroplating bath drives the solar cell to move from an inlet to an outlet of the moving mechanism of the solar cell, thus achieving electroplating of the solar cell during energization and the horizontal transportation to form an electroplated electrode region comprising electroplated electrodes;
wherein:
the seed layer consists of a main component and an additional component; the main component is Al having a mass content greater than or equal to 70 wt. % of the seed layer, and the additional component is a metal selected from Mo, Ti, W, Cr, Mn, Pd, Bi, Nb, Ta, and Pa; and the additional component has a mass content less than or equal to 30 wt. % of the seed layer; and
a conductive layer is disposed on the seed layer, and the conductive layer comprises Cu....

Claims

The invention claimed is:
1. A heating assembly, comprising a main body and a high-frequency control assembly; wherein:
the main body comprises a heating chamber provided with a first opening;
the main body further comprises a heating element disposed in the heating chamber;
the heating element comprises an elongated sheet and a tube;
one end of the tube is a sealed end, and the other end of the tube is an open end;
the elongated sheet comprises a notch extending along a length of the heating element;
the tube is fixedly disposed in the notch, and the sealed end of the tube abuts against a base of the notch;
the tube comprises a first side wall, a second side wall, and a thermal air chamber surrounded by the first side wall and the second side wall;
the first side wall and the second side wall are convex with respect to the elongated sheet;
each of the first side wall and the second side wall comprises at least one first through hole;
the high-frequency control assembly is disposed outside the heating chamber;
when in use, a tobacco material passes through the first opening and is disposed into the heating chamber; and
when the high-frequency control assembly is energized, an electromagnetic filed is produced, and the heating element produces heat to heat the tobacco material.
2. The heating assembly of claim 1, wherein the high-frequency control assembly comprises a coil and a power supply unit; the coil is configured to produce an electromagnetic field that enables the heating element to produce heat; the power supply unit is electrically connected to the coil to provide alternating current to the coil; the coil is wound into a helix with a hollow space; and the heating chamber is disposed in the hollow space.
3. The heating assembly of claim 2, wherein the power supply unit comprises a battery and a high-frequency control board; the battery is electrically connected to the high-frequency control board to supply power to the high-frequency control board; the high-frequency control board is further electrically connected to the coil and a temperature sensor so as to provide alternating current to the coil and receive information about the temperature changes of the heating element.
4. The heating assembly of claim 3, wherein the main body further comprises a housing and a bracket; the housing comprises a first end provided with a cavity; the bracket is disposed in the housing; the bracket comprises an empty space; and the high-frequency control assembly is disposed in the empty space and the coil is disposed in the cavity.
5. The heating assembly of claim 4, wherein the main body further comprises a cover provided with a first end; the first end is concave to form a first recess; the first recess comprises a first bottom wall provided with a second opening; the cover further comprises an air duct communicating with the second opening; and the air duct extends into the hollow space.
6. The heating assembly of claim 5, wherein the main body further comprises a fixing member configured to hold the tobacco material; one end of the fixing member is concave to form a second recess; the second recess comprises a second bottom wall and the first opening is disposed on the second bottom wall; the fixing member comprises a sliding member disposed in the second recess and slidable along an inner wall of the second recess; the other end of the fixing member is in the form of a necked part which is matched with an inner wall of the first recess in size and shape; the fixing member further comprises a hollow tube communicating with first opening through the necked part; the hollow tube corresponds with the first opening; and the hollow tube functions as the heating chamber.
7. The heating assembly of claim 6, wherein the fixing member is detachably disposed in the cavity; the necked part is disposed into the first recess; the hollow tube is disposed through the second opening into the air duct; and an air channel is formed between an outer wall of the hollow tube and an inner wall of the air duct.
8. The heating assembly of claim 7, wherein the main body further comprises a seal member disposed in one end of the air duct and configured to seal the air channel; the seal member comprises a third recess provided with a second through hole; one end of the heating element is fixedly disposed in the third recess so that the thermal air chamber communicates with the second through hole; and the temperature sensor comprises a conducting wire connected through the second through hole to the high-frequency control board.
9. The heating assembly of claim 1, wherein the heating assembly further comprises a temperature sensor and the thermal air chamber comprises a separate chamber; the temperature sensor is disposed in the separate chamber; the heating element is in an elongated shape; the separate chamber is disposed in the middle of the heating element and extends along the length of the heating element....

Claims

What is claimed is:
1. A heating cup assembly, comprising a first cup;
wherein
the first cup comprises a first cavity, a first side wall, and a second side wall; the first cavity is surrounded by the first side wall; the first side wall comprises a first end and a second end; the second side wall comprises a third end and a fourth end; the second end and the third end are disposed in one horizontal plane; the second side wall is in the shape of a truncated cone, and a diameter of the third end is less than that of the fourth end;
a connecting wall is connected to the second end of the first side wall and the third end of the second side wall;
the heating cup assembly further comprises a second cup detachably disposed in the first cavity; and the second cup comprises a third side wall and a second cavity surrounded by the third side wall;
the third side wall is longer than the first side wall; and
the second side wall extends beyond a top of the second cup.
2. The heating cup assembly of claim 1, wherein the first end is connected to a first bottom wall.
3. The heating cup assembly of claim 2, wherein one end of the third side wall comprises a second bottom wall; and the third side wall and/or the second bottom wall comprises a heating layer.
4. The heating cup assembly of claim 3, wherein the heating layer is disposed in a cavity of the third side wall, and/or is attached to an inner surface of the third side wall and/or an outer surface of the third side wall; and the heating layer comprises metal, carbon nanomaterial, or graphene.
5. The heating cup assembly of claim 1, wherein one end of the third side wall extends radially towards the first cup to form a flange.
6. A hookah, comprising a heater and the heating cup assembly of claim 1; wherein the heating cup assembly is detachably disposed on the heater.
7. The hookah of claim 6, wherein the heater comprises a fourth side wall and a top concave portion surrounded by the fourth side wall; the hookah further comprises a coil wrapped around the fourth side wall; and the heating cup assembly is detachably connected to the top concave portion....